We narrowed to 4,082 results for: Gaa
-
Plasmid#85656Purposeexpression of shRNA targeting human MAP3K2DepositorInsertshRNA targeting 3'UTR of MAP3K2 (MAP3K2 Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
DCK gRNA (BRDN0001148859)
Plasmid#78057Purpose3rd generation lentiviral gRNA plasmid targeting human DCKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
COL4A3BP gRNA (BRDN0001147254)
Plasmid#77850Purpose3rd generation lentiviral gRNA plasmid targeting human COL4A3BPDepositorInsertCOL4A3BP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TESK2 gRNA (BRDN0001146547)
Plasmid#76432Purpose3rd generation lentiviral gRNA plasmid targeting human TESK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
N4BP2 gRNA (BRDN0001146240)
Plasmid#76336Purpose3rd generation lentiviral gRNA plasmid targeting human N4BP2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NEK5 gRNA (BRDN0001146851)
Plasmid#76117Purpose3rd generation lentiviral gRNA plasmid targeting human NEK5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MYO3B gRNA (BRDN0001145051)
Plasmid#75568Purpose3rd generation lentiviral gRNA plasmid targeting human MYO3BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX_sh_hBcl10_#16
Plasmid#75253Purposeretroviral shRNA vector against human BCL10, expresses GFP for transduction controlDepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-cfSec15A_2
Plasmid#26715DepositorInsertDog Sec15A RNAi (EXOC6 C. familiaris (dog RNAi))
UseLentiviral and RNAiExpressionMammalianMutationDog Sec15A RNAi.Available SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Rabep1 shRNA 369958-CMV-delta5_2 Rabep1
Plasmid#254778PurposeRabep1 shRNA 369958 with expression of Rabep1 trucation lacking rab5 binding domain in pLKO backboneDepositorInsertshRNA 369958 and truncated Rabep1 (RABEP1 Human)
UseLentiviralMutation5/2 deletionPromoterCMVAvailable SinceMay 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgDROSHA-7-hUbC-dCas9-KRAB-T2a-Puro
Plasmid#255343PurposeCRISPRi targeting DROSHADepositorInsertsgDROSHA-7
UseCRISPR and LentiviralAvailable SinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-hITGB1-gRNA2
Plasmid#249223PurposeITGB1 CRISPR KODepositorAvailable SinceFeb. 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-CCND1shRNA3
Plasmid#220579PurposeTo inducibly knockdown CCND1 expressionDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN, L177D
Plasmid#180649PurposeLentiviral expression vector for SPASTIN. Has L177D mutation. Used for generating cell lines. Has N-terminal mCherry tag. Dox-inducible. SPASTIN starts on M87. Internal ID: WISP20-45.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, L177D mutation, has siRNA resistan…Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-DSP
Plasmid#185549PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting DSPDepositorInsertDSP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
SH3BP4 gRNA (BRDN0001149502)
Plasmid#78088Purpose3rd generation lentiviral gRNA plasmid targeting human SH3BP4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LRGUK gRNA (BRDN0001487051)
Plasmid#78086Purpose3rd generation lentiviral gRNA plasmid targeting human LRGUKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IRAK2 gRNA (BRDN0001148674)
Plasmid#77731Purpose3rd generation lentiviral gRNA plasmid targeting human IRAK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only