We narrowed to 4,839 results for: pcr
-
Plasmid#165570PurposeSignificantly improves maximum amplicon size and PCR yields for Family B polymerases like Pfu or Phusion. Comparable to ArchaeMaxx/PfuTurbo.DepositorInsertP45
UseSynthetic BiologyAvailable sinceAug. 23, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVITRO1-dV-IgE/λ
Plasmid#61879PurposeHuman immunoglobulin epsilon antibody expression vector (lambda light chain) without variable regions. Enables Colony-PCR screening of false-positive (PCR vector template) coloniesDepositorInsertsHuman immunoglobulin Epsilon constant region
Human immunoglobulin lambda constant region
ExpressionMammalianMutationDeleted Variable regionPromotermEF1 Prom and rEF1 PromAvailable sinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCR-Blunt_hNANOG
Plasmid#112639PurposePlasmid for PCR amplification of hNANOG DNA template for in vitro transcriptionDepositorAvailable sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPT-PCR C2
Plasmid#141247PurposePCR cloned Phaeodactylum tricornutum Mitochondrial Genome - Clone 2DepositorPublicationInsertMitochondrial Genome of Phaeodactylum tricornutum
UseSynthetic Biology; Diatom expressionExpressionBacterial and YeastMutationRepeat region removed, additional minor mutations…Available sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR-Blunt_hM3O
Plasmid#112638PurposePlasmid for PCR amplification of hM3O DNA template for in vitro transcriptionDepositorInserthM3O
UsePcr templatePromoterT7Available sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCri System
Plasmid kit#1000000058PurposePlasmids used for cytoplasmic and periplasmic/extracellular heterologous protein expression in E. coli, Bacillus subtilis, and Pichia pastoris.DepositorApplicationGene Expression and LabelingVector typeBacterial Expression, Yeast ExpressionAvailable sinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPT-PCR C1
Plasmid#141248PurposePCR cloned Phaeodactylum tricornutum Mitochondrial Genome - Clone 1DepositorPublicationInsertReduced Mitochondrial Genome of Phaeodactylum tricornutum
UseSynthetic Biology; Diatom expressionExpressionBacterial and YeastMutationRepeat region removed, additional minor mutations…Available sinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCR-Blunt_mWasabi
Plasmid#112640PurposePlasmid for PCR amplification of mWasabi DNA template for in vitro transcriptionDepositorInsertmWasabi
UsePcr templatePromoterT7Available sinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-INS-904
Plasmid#53970Purpose904 bp insert from human INS gene used as a control for methylation-specific PCR assaysDepositorAvailable sinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
JI401: Ad5 E1A/Hexon qRT-PCR standard
Plasmid#131753PurposePlasmid standard containing regions of the Ad5 E1A and Ad5 Hexon genes to create a qRT-PCR standard curve for detection of replication competent adenovirus (RCA).DepositorInsertsAd5 E1A gene fragment
Ad5 Hexon gene fragment
UseStandard for qrt-pcrPromoterN/AAvailable sinceOct. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
Yeast GPCR-sensor Toolkit
Plasmid kit#1000000157PurposeThis toolkit includes plasmids for constructing highly-tunable GPCR-based biosensors in yeast.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector typeYeast ExpressionCloning typeGolden Gate (MoClo)Available sinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCR2.1-Ins2-842
Plasmid#53969Purpose842 bp insert from mouse Ins2 gene used as a control for methylation-specific PCR assaysDepositorAvailable sinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJW1311
Plasmid#61254PurposeTemplate for cloning sgRNA(F+E) to generate new PU6::sgRNAs by PCR-fusionDepositorInsertsgRNA(F+E) targeting Y61A9L9.1
UseCRISPR; Cloning templateAvailable sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCBC-MT1T2
Plasmid#50593PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, gRNA scaffold, OsU3t plus, TaU3p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable sinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJW1310
Plasmid#61253PurposeTemplate for cloning U6 promoter to generate new PU6::sgRNAs by PCR-fusionDepositorInsertU6 promoter
UseCRISPR; Cloning templateAvailable sinceDec. 18, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEPkan-S
Plasmid#41017PurposePCR template for en passant (two-step Red-mediated) mutagenesisDepositorInsertKana_I-SceI
Available sinceJan. 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBP-T7RNAP
Plasmid#74096PurposeT7 RNA polymerase PCR cloned from BL21 (DE3) genomic DNADepositorPublicationInsertT7 RNAP
UseSynthetic BiologyExpressionBacterialPromoterNoneAvailable sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pScarlessHD-sfGFP-DsRed
Plasmid#80811PurposeVector containing a cassette for scarless insertion of sfGFP and marked by the visible marker 3xP3-DsRed flanked by piggyBac termini.DepositorInsertsfGFP-piggyBac-DsRed
UseUnspecifiedTagssfGFPAvailable sinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by