176,133 results
-
Plasmid#222342PurposePlasmid for evolved and engineered Bxb1 mRNA in vitro transcription templateDepositorInsertCodon-optimized evolved and engineered Bxb1
UseTemplate for in vitro transcriptionPromoterT7 (inactivated)Available SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5ā-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (AAV9)
Viral Prep#104492-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (#104492). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7f-WPRE plasmid DNA. Syn-driven, Cre-dependent GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-CD36-C-10
Plasmid#54030PurposeLocalization: Membrane, Excitation: 487, Emission: 509DepositorAvailable SinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMRXIP Turquoise2-Syntaxin17
Plasmid#89938PurposeExpresses Syntaxin17 tagged with Turquoise2 in mammalian cellsDepositorAvailable SinceJune 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP GFP-SNAP29
Plasmid#45923DepositorAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
VAMP7 HA-delta pMEP4
Plasmid#62958Purposefull length human VAMP7 with C-terminal HA tag cloned into delta pMEP4DepositorAvailable SinceMay 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
PADH1-TIR1-9myc-URA3
Plasmid#207016PurposeExpresses TIR1-9Myc. TIR1 mediates auxin-induced ubiquitination of auxin-inducible degron (AID).DepositorInsertTIR1
Tags9xMycExpressionYeastPromoterpADH1Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV/D377Y-mPCSK9
Plasmid#58376PurposeExpresses GoF mutant murine PCSK9 to be used for rAAV8-mediated gene transfer, hypercholesterolemia and atherosclerosisDepositorHas ServiceAAV8Insertproprotein convertase subtilisin/kexin type 9 (Pcsk9 Mouse)
UseAAVExpressionMammalianMutationD377YPromoterHCRApoE/hAATAvailable SinceAug. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
DYRK1A/pTRE3G-FL-hXIST
Plasmid#149608PurposeExpress doxycycline-inducible full length of human XIST cDNADepositorAvailable SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
CFTR-HiBiT Fusion Vector
Plasmid#236890PurposeExpress CFTR WT HiBiT in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertCFTR with HiBiT internally on an extracellular loop (CFTR Human)
ExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Syn-ChR2(H134R)-GFP (AAV8)
Viral Prep#58880-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Syn-ChR2(H134R)-GFP (#58880). In addition to the viral particles, you will also receive purified pAAV-Syn-ChR2(H134R)-GFP plasmid DNA. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsGFPAvailable SinceOct. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti sfGFP-LAMP1-mCherry (pHLARE)
Plasmid#164478PurposeLysosomal pH biosensor consisting of sfGFP-rat Lamp1-mCherry. Plasmid for lentivirus production.DepositorInsertLAMP1 (Lamp1 Rat)
UseLentiviralTagsmCherry and superfolder GFPExpressionMammalianPromoterCMVAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR_EGFPligand
Plasmid#79129PurposeLentiviral vector for surface expressed EGFP (SFFV promoter)DepositorInsertEGFP surface ligand
UseLentiviralAvailable SinceJuly 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1a_TauFRET_3xKQ_wpre
Plasmid#207522PurposeLentiviral construct for the expression of a FRET-based reporter for tau seeding in mammalian cellsDepositorInsertTauFRET_P301L_3xKQ
UseLentiviralTagsNeonGreen and mTurquoise2MutationP301L; K311Q; K317Q; K321QPromoterEF1aAvailable SinceOct. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLT06
Plasmid#255019PurposeMarkerless deletion vector that enables manipulation of enterococcus to either insert DNA or delete DNA from the genome. Contains resistance gene for chloramphenicol resistance.DepositorTypeEmpty backboneAvailable SinceMay 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2-Nanoluc-ccdB
Plasmid#87078PurposeLentiviral Gateway-compatible expression vector backbone with an N-terminal Nanoluc luciferaseDepositorTypeEmpty backboneUseLentiviralTagsNanoluc luciferaseExpressionMammalianAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
HA-Ubiquitin
Plasmid#18712PurposeMammalian expression of human ubiquitin with HA tagDepositorInsertubiquitin (UBB Human)
TagsHAExpressionMammalianMutationThe HA-Ubiquitin insert is from the UBB gene. Theā¦Available SinceJune 20, 2008AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-EGFP
Plasmid#52343PurposeAAVS1 donor vector for inducible gene expressionDepositorInsertEGFP
ExpressionMammalianPromoterTRE3GAvailable SinceNov. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF3143
Plasmid#144619PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only