We narrowed to 9,135 results for: sgRNA
-
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJH009_proD_Cas12c-sgRNA-GFP_CAM
Plasmid#183070PurposePlasmid expressing Cas12c sgRNA targeting GFP (1) for in vivo interference assay in bacteria.DepositorInsertCas12c single guide RNA targeting GFP
UseCRISPRExpressionBacterialAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-empty-GFP
Plasmid#221843Purposeempty vector to clone custom sgRNA into BsaI sites to express sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertEGFP
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterCAGCAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti ccdB Dang sgRNA Hyg sfGFP
Plasmid#235047PurposeLentiviral sgRNA expression with optimized sgRNA scaffold vector with hygromycin and superfolder GFP. Also contains ccdB cassette for library cloning.DepositorArticleTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceApril 30, 2026AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-BFP
Plasmid#188776PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLSDepositorInsertZim3-dCas9-mTagBFP2
UseLentiviralTagsHA-2xNLS-mTagBFP2 and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb MMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97311PurposeMMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb MMEJ donor
UseAAV and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti_Actb HMEJ donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97312PurposeHMEJ donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. Lenti backbone.DepositorInsertActb HMEJ donor
UseLentiviral and Mouse TargetingExpressionMammalianPromoterU6, EF1aAvailable SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
double_sgRNA targeting e1 and e4
Plasmid#190688PurposesgRNAs targeting enhancer 1 and 4 of MYC separatelyDepositorInsertsgRNAs targeting enhancer 1 and 4 of MYC separately
UseCRISPR, Lentiviral, and Synthetic BiologyTagsBFP and PuromycinExpressionMammalianAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM148: pAAV.CMV-Cas13e-NT sgRNA
Plasmid#203446PurposePlasmid expressing active RfxCas13d with non-targeting gRNADepositorInsertsU6-non targeting (NT) sgRNA
Cas13e
UseAAVTagsHA and NLSExpressionMammalianPromoterCMV and U6Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 2
Plasmid#207610PurposesgRNA 2 to knockout TR by replacement with a PuroR cassetteDepositorInsertTCAGGCCGCAGGAAGAGGAA
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgRNA TR KO 1
Plasmid#207609PurposesgRNA 1 to knockout TR by replacement with a PuroR cassetteDepositorInsertACCCTAACTGAGAAGGGCGT
TagsNoneExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-evoSpCas9 (without sgRNA; with silent mutations)
Plasmid#126758PurposeExpression plasmid for human codon-optimized increased fidelity evoSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertevoSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationM495V, Y515N, K526E, R661QPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HeFSpCas9 (without sgRNA; with silent mutations)
Plasmid#126759PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHeFSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-WT_SpCas9 (without sgRNA; with silent mutations)
Plasmid#126753PurposeExpression plasmid for human codon-optimized WT SpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertWT SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianPromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-eSpCas9 (without sgRNA; with silent mutations)
Plasmid#126754PurposeExpression plasmid for human codon-optimized increased fidelity eSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInserteSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, K1003A, R1060APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-HypaSpCas9 (without sgRNA; with silent mutations)
Plasmid#126756PurposeExpression plasmid for human codon-optimized increased fidelity HypaSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertHypaSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN692A, M694A, Q695A, H698APromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only