We narrowed to 42,628 results for: tro
-
Plasmid#241244PurposeNegative control vrial expression vector for Cre-dependent expression plasma membrane-tethered ibARK with higher specificity in astrocytesDepositorInsertDIO-Lck-mCherry-ibARK(D110A)-4x6T
UseAAVMutationD110AAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Non-Targeting
Plasmid#241026PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of a non-targeting sgRNA; used as control for SaCas9 based knock-outs in murine astrocytesDepositorInsertU6 driven empty sgRNA
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDGB3_alpha2_BeYDV geminino 2.0 (no ATG)-eGFP (GB5178)
Plasmid#225443PurposeGeminino 2.0-no ATG on CDS. BeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1.DepositorInsertBeYDV LIR1 + 2nd half intron ICON MP + eGFP w/o ATG + t35S:SIR + P35s + 1st half of intron from ICON MP + BeYDV LIR1
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMY-Lyz2-GSG-mCherry
Plasmid#163346PurposeRetroviral vector to express C-terminally mCherry-tagged murine Lyz2DepositorAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Bcan-Ntrk1_4
Plasmid#136413PurposeLentiviral expression of gRNAs targeting intron 13 of murine Bcan and intron 10 of murine Ntrk1. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Bcan)_U6_sgRNA(Ntrk1)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-Myb-Qk_1
Plasmid#136415PurposeLentiviral expression of gRNAs targeting intron 4 of murine Qk and intron 9 of murine Myb. Also constitutively expresses Puromycin linked to TagBFP.DepositorInsertU6_sgRNA(Myb)_U6_sgRNA(Qk)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-lyzC-mcherry-2a-CDK2-D145N
Plasmid#121132Purposeneutrophil specific expressionDepositorInsertdre-D145N CDK2 DN (cdk2 Zebrafish)
Tagsmcherry-2aExpressionBacterialMutationD145N point mutation DNPromoterneutrophil specific lyzCAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2_Bod1l_Sense
Plasmid#124443PurposePlasmid for sense in situ probe in vitro transcriptionDepositorInsertBiorientation of chromosomes in cell division 1-like (Bod1l Mouse)
UseIn situ probePromoterT7Available SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRA/PINCO
Plasmid#108938PurposeRetroviral expression of mRIN2 dRADepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationDeletion of RA domain (aa 751-836)PromoterLTRAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-mRIN2 dRHVPS9/PINCO
Plasmid#108939PurposeRetroviral expression of mRIN2 dRHVPS9DepositorInsertRas and Rab interactor 2 (Rin2 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationDeletion of RHVPS9 domain (aa 455-738)PromoterLTRAvailable SinceJune 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDX2 ObLiGaRe Donor vector/EPB64
Plasmid#90017PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to CDX2 exon1 locusDepositorInsertMCS flanked by inverted CDX2 ZFN binding sites (CDX2 Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pQCXIB-FLAG-hDIXDC1-L-S592A
Plasmid#61225PurposeRetrovirus expressing long isoform of human DIXDC1DepositorAvailable SinceMarch 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Hygro-FLAG-hDIXDC1 S592A
Plasmid#61214PurposeRetrovirus expressing long isoform of human DIXDC1DepositorAvailable SinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
nes714Δ1388-1507tk/lacZ
Plasmid#47616Purposeused to create transgenic mice expressing LacZ reporter with Nestin enhancerDepositorInsertnestin 2nd intron fragment (NES Human)
UseEnhancer reporterTagsHSV tk promoter and lacZMutation714 bp from 3' end of 2nd intron with a dele…PromoterHSV tk promoterAvailable SinceAug. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
pvPE-V4
Plasmid#240288PurposeEncodes fourth generation porcine endogenous retrovirus-derived prime editing (pvPE) system into mammalian cells for gene editing.DepositorInsertpvPE-V4
UseCRISPRTagsSV40 NLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF140_Gag-SpyCas9-NLS
Plasmid#225959PurposeCMV-Intron-Gag-SpyCas9-NLS. Expresses Gag-SpyCas9-NLS for VLP production.DepositorInsertCMV-Intron-Gag-SpyCas9-NLS
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF160_VSV-G
Plasmid#225963PurposeCMV-Intron-VSVG (env protein). Expresses VSV-G env for VLP production.DepositorInsertCMV-Intron-VSVG (env protein)
ExpressionMammalianAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL21-VEX
Plasmid#158230PurposeRetroviral expression plasmid of sgRNA with violet-excited fluorescent protein (VEX)DepositorTypeEmpty backboneUseCRISPR and RetroviralExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only