We narrowed to 9,039 results for: sgRNA
-
Plasmid#176666PurposeExpression of sgRNA under D. melanogaster U6-3 _(CR31539) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pLC-Flag-UBE2G1 sg2R-P2A-Hygro
Plasmid#124299PurposeLentiviral vector for expression of Flag tagged UBE2G1-P2A-Hygro casette from a CMV promoter. UBE2G1 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertUBE2G1 (UBE2G1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4B-Cquin_596
Plasmid#176669PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039596) promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT15416-BEAR-mScarlet-target-BFP
Plasmid#162996Purposeplasmid expressing an sgRNA targeting the BEAR-mScarlet plasmid along with a TagBFP markerDepositorInsertsgRNA targeting the BEAR-mScarlet plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aalb_726
Plasmid#176661PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029726) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_763
Plasmid#176658PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017763) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL11057
Plasmid#68253PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_1 in barleyDepositorInsertPromote:TaU6+sgRNA HvPM19_1
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC548
Plasmid#62316PurposesgRNA with 1x PP7 for yeast cellsDepositorInsertsgRNA + 1x PP7
ExpressionYeastPromoterSNR52Available SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-eSpCas9
Plasmid#126769PurposeExpression of increased fidelity eSpCas9 in bacterial cellsDepositorInserteSpCas9
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, K1003A, R1060APromoterT7Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX-APRT-sg2
Plasmid#107274PurposeAPRT sgRNA-2 and Cas9 expression vectorDepositorInsertAPRT sgRNA-2
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC35
Plasmid#62325PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC102
Plasmid#62337PurposesgRNA for mammalian cells with mCherry markerDepositorInsertsgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJMP2656
Plasmid#248701PurposeZ. mobilis CRISPRi version 2, promoter C, empty guideDepositorInsertempty sgRNA
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK2
Plasmid#233897Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADK2DepositorInsertsgRNA targeting NADK2 (NADK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPH021
Plasmid#234346PurposeLibrary-scale IPTG-inducible single transcript dual-gRNA expression for Type II dCas9 in Synechococcus sp. PCC 7002, genomically integrated next to glpKDepositorInsertsType II dCas9 sgRNA
Type II dCas9 sgRNA
UseCRISPRExpressionBacterialPromoterlacUV5Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(A)
Plasmid#236039PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(A) expresses the dCas12a endonuclease and the sgRNA (design A) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
p931-SWITCH-OVER insert: EF1a-Blasti
Plasmid#217890Purposeinsert vector for Switch-OVER: Single loxP-STOP-EF1a-Blasti-mU6DepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only