We narrowed to 35,837 results for: CaS
-
Plasmid#196375PurposeAkt1 kinase negative mutant K179M in avian expression vectorDepositorInsertc-akt1 K179M
UseRetroviral; AvianTagsHAAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
RCAS myr-c-P3k
Plasmid#196373PurposeOncogenic with addition of a myristylation signal and expresses in avian cellsDepositorInsertMyr-c-P3k-FLAG
UseRetroviral; AvianTagsflag and myristoylationAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
CASK scFv [K56A/57]
Plasmid#190492PurposeMammalian Expression of CASK scFV. Derived from hybridoma K56A/57.DepositorInsertCASK (Homo sapiens) recombinant scFV (CASK Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
CASK scFv [K56A/50]
Plasmid#190491PurposeMammalian Expression of CASK scFV. Derived from hybridoma K56A/50.DepositorInsertCASK (Homo sapiens) recombinant scFV (CASK Mouse)
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
Anti-CASK [K56A/57]
Plasmid#190283PurposeMammalian Expression Plasmid of anti-CASK (Human). Derived from hybridoma K56A/57.DepositorInsertanti-CASK (Homo sapiens) recombinant Mouse monoclonal antibody (CASK Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUBI-RZ-Cas12j2
Plasmid#189781PurposeCas12j2 (CasΦ) Gateway gRNA entry plasmid using Zea mays Ubi promoter and HH, HDV ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28_redesigned_Caspase-4_ANR261ENP_D315H_M318K_T352K_enzymatic domain
Plasmid#183387PurposeOverexpression of catalytic domain of inflammatory caspase in bacteriaDepositorInsertredesigned Caspase-4 (AA94-377) (CASP4 Human)
TagsHis-TEVExpressionBacterialMutationANR261ENP, D315H, M318K, T352KPromoterT7Available SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15541_dCBE-SuperFi-Cas9
Plasmid#184371PurposeMammalian expression of nuclease inactive SuperFi-Cas9 CBE base editorDepositorInsertdCBE-SuperFi-Cas9
UseCRISPRTags3X FLAG, SV40 NLS, and UGIExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15543_dABE-SuperFi-Cas9
Plasmid#184373PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE7 base editorDepositorInsertdABE-SuperFi-Cas9
UseCRISPRTagsFLAG, SV40 NLS, and nucleoplasmin NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15545_dABE8e-SuperFi-Cas9
Plasmid#184375PurposeMammalian expression of nuclease inactive SuperFi-Cas9 ABE8e base editorDepositorInsertdABE8e-SuperFi-Cas9
UseCRISPRTagsNucleoplasmin NLS and SV40 NLSExpressionMammalianMutationD10A, H840A, Y1010D, Y1013D, Y1016D, V1018D, R101…PromoterEF-1α core promoterAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-H2BC11_sgRNA
Plasmid#183883PurposepX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-MYH10_sgRNA
Plasmid#183887PurposepX459V2.0-HypaCas9 plasmid with MYH10 sgRNA for N-terminal tagging of myosin heavy chain 10 in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-CfANLN_sgRNA
Plasmid#183880PurposepX459V2.0-HypaCas9 plasmid with cfANLN sgRNA for N-terminal tagging of anillin in canine (Canis familiaris) cells.DepositorInsertCanis familiaris ANLN sgRNA spacer
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_103 SpCas9 T1337C
Plasmid#179525PurposeFor bacterial expression of SpCas9 T1337C (for DNA cross-linking) with an N-terminal His-MBP tagDepositorInsertSpCas9 T1337C
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationchanged threonine 1337 to cysteineAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
1137B=Hsp70Bb-Cas9
Plasmid#153284PurposeThe attB plasmid harboring the Hsp70Bb-Cas9-T2A-eGFP-p10 and a mini-white marker.DepositorInsertpHsp70Bb-SpCas9-T2A-eGFP-p10 (cas9 Synthetic)
UseCRISPRTagseGFPExpressionInsectPromoterDmel Hsp70BbAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA1-gltA2
Plasmid#71348PurposegltA1-gltA2 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgltA1-gltA2 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-udhA-xylA
Plasmid#158612PurposeLow phosphate inducible gRNA array to silence the xylA and udhA promotersDepositorInsertudhA-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-gltA2-xylA
Plasmid#158613PurposeLow phosphate inducible gRNA array to silence the xylA and gltA2 promotersDepositorInsertgltA2-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCASCADE-zwf-xylA
Plasmid#158614PurposeLow phosphate inducible gRNA array to silence the xylA and zwf promotersDepositorInsertzwf-xylA guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only