We narrowed to 6,257 results for: tTA
-
Plasmid#204672PurposeDual gRNA plasmid for UCK2 deletionDepositorAvailable SinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only
-
SF3B3
Plasmid#156003PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
RBMX2-1
Plasmid#155915PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
PHF6
Plasmid#155821PurposeFor use in RBP tethering screenDepositorAvailable SinceSept. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR-flag-Lag16-fibcon-iCAM1-tether
Plasmid#205213PurposeThis vector encodes of the synCAM tether (fibcon - iCAM1) and GFP nanobody LAG16DepositorInsertsynCAM fibcon - iCAM1 Tether and Lag16 anti-GFP nanobody
UseLentiviralExpressionMammalianAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
TOE1
Plasmid#156091PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
RBM41
Plasmid#155902PurposeFor use in RBP tethering screenDepositorAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.178
Plasmid#184999PurposeExpress -Eco1 FANCF editing ncRNA and gRNADepositorInsertEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationFANCF donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.179
Plasmid#185000PurposeExpress -Eco1 HEK4 editing ncRNA and gRNADepositorInsertEco1: HEK4 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK4 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMERVK10c_2 (inducible)
Plasmid#189956PurposeshRNA mediated knockdownDepositorInsertERV_MMERVK10c
UseLentiviralAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMETn_1 (inducible)
Plasmid#189953PurposeshRNA mediated knockdownDepositorInsertERV_MMETn
UseLentiviralAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMERVK10c_2
Plasmid#185021PurposeshRNA mediated knockdownDepositorInsertERV_MMERVK10c
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMETn_1
Plasmid#185018PurposeshRNA mediated knockdownDepositorInsertERV_MMETn
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-H2BC11_sgRNA
Plasmid#183883PurposepX459V2.0-HypaCas9 plasmid with H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-H2BC11_sgRNA
Plasmid#183881PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and H2BC11 sgRNA for C-terminal tagging of H2B histones in human cells.DepositorAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC51
Plasmid#104825PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.12g075700, Glyma.11g145900 (Drb2ab). Also expresses Cas9 from rolD promoter from Gmubi promoterDepositorInsertGlyma.12g075700, Glyma.11g145900
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET21a Ec-iPGM-bio
Plasmid#162575PurposeExpresses E. coli iPGM containing a C-terminal biotinylation site and His tagDepositorInsertE. coli iPGM bio-6His
Tags6His tag, T7 tag, biotinylation sequence, and thr…ExpressionBacterialPromoterT7Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH2 #7
Plasmid#166102PurposeThis plasmid express a sgRNA that targets the IDH2 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH2-135 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pROS13_IDH1 #4
Plasmid#166101PurposeThis plasmid express a sgRNA that targets the IDH1 gene. This allows Cas9 to make a double-strand break and facilitate integration of LOV2 at position IDH1-67 by homologous recombination.DepositorArticleAvailable SinceApril 16, 2021AvailabilityAcademic Institutions and Nonprofits only