We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
Plasmid#177935PurposeExpresses sgRNA and can be packaged into AAV particles for somatic delivery into Cas9 transgenic miceDepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pEJS1084_pTetR-P2A-BFP/BspMI flexible sgRNA
Plasmid#117687PurposeU6 driven Spy sgRNA cloning vector where guide sequences are inserted between BspMI sites. This plasmid works with Addgene #108570 for subnuclear proteomic profiling via C-BERST method.DepositorInsertsKanamycin cassette
TetR-P2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromoterU6 and hPGKAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_2
Plasmid#155085Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_3
Plasmid#155089Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_3
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_3
Plasmid#155086Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_3
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_AAVS1_sgRNA_4
Plasmid#155087Purposelentiviral plasmid expressing Cas9 gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_4
Plasmid#155090Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_4
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
TU#1806_CRISPR_unc-73_exon21
Plasmid#82360Purposeto create unc-73E null alleleDepositorInsertCas9 and sgRNA against unc-73 exon21 (unc-73 Nematode)
UseCRISPRExpressionWormPromoterU6Available SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
TU#1805_CRISPR_unc-73_exon2
Plasmid#82359Purposeto create unc-73B null alleleDepositorAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgCnr1
Plasmid#209196PurposeMutagenesis of Cnr1DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1303-AAV-EFSNC-dCjCas9-MECP2(204-310)
Plasmid#223148PurposeExpression of truncated MECP2 with dCjCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1300-AAV-EFSNC-dCjCas9-MBD2(176-231)
Plasmid#223145PurposeExpression of truncated MBD2 with dCjCas9 and empty gRNA scaffoldDepositorInsertMBD2 (MBD2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 176-231PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1299-AAV-EFSNC-dCjCas9-MBD1(529-592)
Plasmid#223144PurposeExpression of truncated MBD1 with dCjCas9 and empty gRNA scaffoldDepositorInsertMBD1 (MBD1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 529-592PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1306-AAV-EFSNC-dSaCas9-HP1aNH(115-177)
Plasmid#223151PurposeExpression of truncated HP1a with dSaCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 115-177PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1296-AAV-EFSNC-dCjCas9-HP1aNH(115-177)
Plasmid#223141PurposeExpression of truncated HP1a with dCjCas9 and empty gRNA scaffoldDepositorInsertHP1a (CBX5 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 115-177PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1309-AAV-EFSNC-dSaCas9-MBD1(529-592)
Plasmid#223154PurposeExpression of truncated MBD1 with dSaCas9 and empty gRNA scaffoldDepositorInsertMBD1 (MBD1 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 529-592PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1313-AAV-EFSNC-dSaCas9-MECP2(204-310)
Plasmid#223158PurposeExpression of truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1310-AAV-EFSNC-dSaCas9-MBD2(176-231)
Plasmid#223155PurposeExpression of truncated MBD2 with dSaCas9 and empty gRNA scaffoldDepositorInsertMBD2 (MBD2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 176-231PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF1_sgRNA
Plasmid#246403PurposeCas9/sgRNA expression plasmid targeting PHF1DepositorInsertPHF1 (PHF1 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgTK
Plasmid#122852PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum TK geneDepositorInsertsCas9-GFP
U6-sgTK
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pACT1:Cas9-GFP, U6:sgUPRT
Plasmid#122853PurposeExpresses Cas9 fused with GFP and a sgRNA targeting the Cryptosporidium parvum UPRT geneDepositorInsertsCas9-GFP
U6-sgUPRT
UseCRISPR; Cas9-gfp plasmid for genome editing of cr…TagseGFPPromoterCryptosporidium parvum U6 and Cryptosporidium par…Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SauriCas9
Plasmid#135964PurposeExpresses SauriCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-Sa-SauriCas9
Plasmid#135967PurposeExpresses Sa-SauriCas9, and cloning backbone for sgRNADepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only