We narrowed to 7,306 results for: GFP expression plasmids
-
Plasmid#65524PurposePlasmid for the generation of gene disruptions via Bxb1-mediated recombination into MIN-tagged cell lines. This vector can also be used to express cDNAs.DepositorInsertattB-GFP
UseMouse Targeting; Bxb1ExpressionMammalianAvailable SinceAug. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK2-2A-GFP
Plasmid#118284PurposeExpresses mouse DYRK2 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 2 (Dyrk2 Mouse)
UseAAVTags2A peptide and GFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DYRK4-2A-GFP
Plasmid#118288PurposeExpresses mouse DYRK4 tagged with 2A peptide at it's C-terminus and GFP in mammalian cells.DepositorInsertdual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4 (Dyrk4 Mouse)
UseAAVTags2A peptide and EGFPExpressionMammalianPromoterCMV with beta global intronAvailable SinceNov. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPB_TRE3G_scFV-sfGFP-Prdm9CD
Plasmid#235577PurposeDox-inducible expression of the catalytic-domain (CD) of epigenetic effector Prdm9 fused with scFV to programme H3K4me3DepositorInsertPrdm9 (Prdm9 Mouse)
UseCRISPRAvailable SinceApril 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLeAPS-GFP-blast
Plasmid#182230PurposeLentiviral transfer plasmid for the LeAPS packaging system; encodes GFP-P2A-blasticidin transgeneDepositorInsertGFP-P2A-Blasticidin
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst44-GFP
Plasmid#172310PurposeSST interneuron-restricted gene regulatory element GRE44, to drive GFP expression in SST+ interneuronsDepositorInsertSst44
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ACE2-GFP
Plasmid#154962PurposepcDNA3.1-ACE2-GFPDepositorAvailable SinceJuly 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP[N150TAA]
Plasmid#164581Purposesuperfolder GFP with N150TAA mutationDepositorInsertsfGFP-150TAA
Tags6xHisExpressionBacterialMutationN150TAA MutationPromoterT7Available SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-RPA70
Plasmid#164231Purposeretroviral plasmid for GFP-RPA70DepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRK5-vox-EGFP
Plasmid#79970Purposemammalian GFP reporter plasmid, target site for Vika recombinaseDepositorInsert2 vox-sites flanking neo in frame with EGFP
ExpressionMammalianPromoterCMVAvailable SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJL1-sfGFP-DQNAT
Plasmid#198210PurposepJL1 plasmid encoding superfolder GFP modified at the C-terminus with 30 amino acids containing an optimal DQNAT sequon followed by a 6x-His tagDepositorInsertsfGFP_DQNAT
Tags6x His Tag and DQNAT glycosylation tagExpressionBacterialPromoterT7Available SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst12-GFP
Plasmid#172311PurposeSST interneuron-restricted gene regulatory element GRE12, to drive GFP expression in SST+ interneuronsDepositorInsertSst12
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT9651-BEAR-GFP
Plasmid#162989PurposeBEAR target plasmid with split EGFP and disrupted 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Sst22-GFP
Plasmid#172312PurposeSST interneuron-restricted gene regulatory element GRE22, to drive GFP expression in SST+ interneuronsDepositorInsertSst22
UseAAVPromoterpB-GlobinAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-GFP-LmnB1
Plasmid#164249Purposeretroviral plasmid for GFP-LmnB1DepositorAvailable SinceMay 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHRdSV40_scFv_GCN4_sfGFP-VPR-GB1_NLS
Plasmid#79373PurposeRecruits VPR to a compatible Cas9 protein for transcriptional activationDepositorInsertGCN4-sfGFP-VPR
UseCRISPRExpressionMammalianAvailable SinceOct. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only