We narrowed to 61,331 results for: promoter
-
Plasmid#66787PurposeExpression of murine PDGFRalpha tagged with GFP under the control of EF1a promoterDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only
-
LC-E75
Bacterial Strain#115925PurposeExpression of dCas9 gene under the control of a weak Ptet promoter in the E. coli chromosomeDepositorBacterial ResistanceNoneAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 R62D actin-3XNLS P2A mCherry
Plasmid#58477PurposeExpresses nuclear-targeted non-polymerizing R62D mutant of human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianMutationChanged Arginine 62 to Aspartic AcidPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-HA-hM3D(Gq)-IRES-mCitrine
Plasmid#50463PurposeGq-coupled hM3D-IRES-mCitrine under the control of human synapsin promoterDepositorInserthM3D(Gq)-IRES-mCitrine (CHRM3 Human)
UseAAVTagsHAMutationSee supplemental documents for DREADD mutationsPromoterhuman Synapsin 1Available SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
Gal4pBS24-Pleum
Plasmid#60327PurposeContains a promoter of two gal binding sites coupled with a core promoter derived from native Leucine promoterDepositorInsertpromoter
UseSynthetic Biology; Yeast synthetic hybrid promote…ExpressionYeastAvailable SinceNov. 6, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVPRT-tTR-KRAB
Plasmid#11648PurposeTet-regulated (Tet-on) lentiviral vector for transgene (hPrion promoter) - OR - shRNA (H1 promoter when subcloned from pLVTHM (Addgene#12247)) - 2nd generationDepositorInserthPrion, GFP, tTR-KRAB, Tet-on
UseLentiviralExpressionMammalianAvailable SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
PGL3-NOXA-N1
Plasmid#26112DepositorAvailable SinceSept. 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
pGEX-Ubc13
Plasmid#18894DepositorAvailable SinceSept. 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L5-CAG-R3
Plasmid#141036PurposeMutisite Gateway mediated vector constructionDepositorInsertCAG promoter
ExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS1293
Plasmid#29144DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsCreAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-UbE2F
Plasmid#15800DepositorAvailable SinceSept. 28, 2007AvailabilityAcademic Institutions and Nonprofits only -
pGL3-fugu SLC2A4 promoter
Plasmid#65101PurposeLuciferase reporter construct under the fugu (Takifugu rubripes) SLC2A4 promoter.DepositorInsertSLC2A4 promoter
UseLuciferaseAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1 actin-3XNLS P2A mCherry
Plasmid#58475PurposeExpresses nuclear-targeted human actin, with an mCherry expression reporter after a P2A protease cleavage site, on a CMV promoterDepositorInsertsTagsmCherryExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
HBV 1.3-mer X-null replicon
Plasmid#65461Purposecontaining 1.3 units of the X-null HBV genome (subtype ayw)DepositorInsert1.3 units of the X-null HBV genome
ExpressionMammalianAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
LV-Sox10MCS5-GFP
Plasmid#115783PurposeThis plasmid encodes for Sox10-MCS5-GFP reporter. Cell carrying this construct expresses green fluorescence under the control of SOX-MCS5 enhancer conjugated with cfos basal promoter.DepositorInsertmouse derived SOX10 Multiple Species Conserved enhancer element 5 conjugated with cfos basal promoter
UseLentiviralTagscfos basal promoter conjugated MCS5 promoter fuse…PromoterSOX10 Multiple Species Conserved enhancer element…Available SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CAG.tdTomato.WPRE.SV40
Plasmid#105554PurposeAAV expression of tdTomato from CAG promoterDepositorHas ServiceAAV1Inserttdtomato
UseAAVExpressionMammalianPromoterCAGAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Flag-H3.3-polyA
Plasmid#59780PurposeExpress Flag-tagged H3.3 (H3F3B) in mammalian cells (CMV promoter). Also suitable for in vitro transcription (T7 promoter) for injecting mRNA into oocytes.DepositorAvailable SinceSept. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-UbE2D4
Plasmid#15786DepositorAvailable SinceSept. 28, 2007AvailabilityAcademic Institutions and Nonprofits only