We narrowed to 14,561 results for: cas9 genes
-
Plasmid#61363Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; inactivating mutation 1396/1397 SY/WW) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 Synthetic, Human, S. pyogenes)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; 1396/1397 SY/WW m…PromoterCMVAvailable SinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-dCas9 KRAB-T2A-GFP
Plasmid#67620PurposeCo-expressed human optimized S. pyogenese dCas9 fused to KRAB repressor domain and GFPDepositorInserthumanized dead Cas9 KRAB T2A GFP
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceMarch 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pDY1330 STITCHR pCMV-nCas9-XTEN-v170_R2Tocc
Plasmid#234826PurposeSTITCHR R2Tocc editorDepositorInsertnCas9h840a-xten-R2Tocc
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A TagRFP-T P2A puro
Plasmid#122200PurposeThe plasmid codes for a Flag-spCas9 protein, a TagRFP-T fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsspCas9
TagRFP-T
UseLentiviralTagsT2AExpressionMammalianAvailable SinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-spCas9 ABE-Umax-ex2-rest1
Plasmid#222143PurposeAdenine base editor with modified TadA variant for extended window and restricted A-to-G base editing in zebrafishDepositorInsertModified TadA-nSpCas9
UseCRISPR; Zebrafish expressionTagsBipartite NLSPromoterT3Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-spCas9 ABE-Umax-ex1-rest1
Plasmid#222140PurposeAdenine base editor with modified TadA variant for extended window and restricted A-to-G base editing in zebrafishDepositorInsertModified TadA-nSpCas9
UseCRISPR; Zebrafish expressionTagsBipartite NLSPromoterT3Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
Catalytically Enhanced (E655G and N696I) -ThermoCas9-3xNLS
Plasmid#254684PurposeExpresses Catalytically Enhanced (E655G and N696I) ThermoCas9 with 3x NLS tags. Utilized for RNP transfectionDepositorInsertCatalytically Enhanced (E655G and N696I) ThermoCas9
TagsNLS, SV40 NLS, and nucleoplasmin NLSExpressionBacterialAvailable SinceMay 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE_16 - pLenti_EFS-Cas9-BLM(1-193)-2A-BlastR
Plasmid#252012PurposeLentiviral mammalian expression of Cas9-BLM(2-194) TruEditorDepositorInsertCas9-BLM(2-194)
UseCRISPR and LentiviralMutationNAAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE2_pLVX-EF1a-dCas9-CBio-IRES-zsGreen1
Plasmid#138418PurposeCAPTURE2.0 vector containing dCas9-CBio, IRES and zsGreen1DepositorInsertdCas9
UseLentiviralTagsBioTAP-tagPromoterEF1aAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAPTURE2_pLVX-EF1a-NBio-dCas9-IRES-zsGreen1
Plasmid#138419PurposeCAPTURE2.0 vector containing NBio-dCas9, IRES and zsGreen1DepositorInsertdCas9
UseLentiviralTagsBioTAP-tagPromoterEF1aAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpCas9-NG-P2A-EGFP (RTW4554)
Plasmid#140001PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9-NG with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCAGAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMMP-MCS-IRES-eGFP-P2A-iCas9
Plasmid#178533PurposeFor genome editing: EGFP-inducible Caspase9 knock-in cassette which allows ablation of target cellsDepositorInsertiCaspase9 (CASP9 Human)
ExpressionMammalianMutationFKBP12 F36 to V Truncated Caspase9 (135-416; lack…Available SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
iF66 PB-LoxStopLox-Zim3-dCas9-mScarlet-hygro
Plasmid#204731PurposeCre-inducible CRISPRi by Zim3-dCas9InsertZim3-dCas9
ExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTE_01 - pLenti_EFS-Cas9-XTEN-ZRANB3-2A-BlastR
Plasmid#251997PurposeLentiviral mammalian expression of Cas9-ZRANB3 TruEditorDepositorInsertCas9-ZRANB3
UseCRISPR and LentiviralMutationNAAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-BFP-PGK-Blast
Plasmid#196720PurposeTet-inducible expression of Cas9-T2A-TagBFPDepositorInsertCas9-T2A-TagBFP
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSPromoterTRE, PGKAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only