We narrowed to 4,082 results for: Gaa
-
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
esgRNA_NbmiR164e/h
Plasmid#231157PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbmiR164e/hDepositorInsertmobile gRNA targeting NbmiR164e/h
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_SlMIR164b
Plasmid#231153PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlMIR164bDepositorInsertmobile gRNA targeting SlMIR164b
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SOX2_HDR
Plasmid#163752PurposegRNA expression vector to target the SOX2 stop codon for HDR gene tagging in human cells.DepositorAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pLentiCRISPR-v2 hygro sgUCK1
Plasmid#211524PurposeDeletes UCK1DepositorInsertsgUCK1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
phH1-GBX2-gRNA
Plasmid#192510PurposeContains gRNA for GBX2DepositorAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORE303N_CEN1
Plasmid#194439PurposeCRISPR, Cas9 driven by double 35S, nptII for plant selection, knockout CEN1DepositorInsertgRNA targeting CEN1
UseCRISPRExpressionPlantPromoterMtU6Available SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-2
Plasmid#180392PurposeProducing AAV that encodes mouse Stk16 shRNA-2 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-ALDH1A3gRNA3
Plasmid#189748PurposeThe construct was used for expression of gRNA for knocking out of the ALDH1A3 gene in Cas9 expressing cells.DepositorInsertALDH1A3 gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS3
Plasmid#174303PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #3 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
p8115 LentiCRISPR v2 sgPTPN14-3
Plasmid#163314PurposeExpresses Cas9 and a human PTPN14-targeting control guide RNADepositorInsertsgPTPN14-3
UseCRISPR and LentiviralPromoterU6Available SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLF6.1.0-gDNA
Plasmid#132435PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertKLF6 (KLF6 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL602 CG
Plasmid#126953PurposeTo target a protospacer with CG at the cut site.DepositorInsertspacer against human genome with CG at cut site
ExpressionMammalianPromoterhuman U6Available SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTBL581 GA
Plasmid#126951PurposeTo target a protospacer with GA at the cut site.DepositorInsertspacer against human genome with GA at cut site
ExpressionMammalianPromoterhuman U6Available SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-