We narrowed to 16,743 results for: grna
-
Plasmid#246552PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd3 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pX459-Fzd6 gRNA
Plasmid#246553PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd6 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd10 gRNA
Plasmid#246554PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd10 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-Puro-U6-gRNA-pA plasmid
Plasmid#247671PurposespCas9 gRNA is driven by human U6 promoter, with the gRNA cassette between PuroR and pA, making it detectable in polyA-based RNA-seq.DepositorInsertPuromycin resistant gene
ExpressionMammalianPromoterTK promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Cd109 gRNA
Plasmid#246571PurposeCRISPR vector co-expressing Cas9 and a mouse Cd109 gRNADepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd9 gRNA
Plasmid#246551PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd9 gRNADepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Itgav gRNA
Plasmid#246576PurposeCRISPR vector co-expressing Cas9 and a mouse Itgav gRNADepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
phU6-LaTranC-sgRNA
Plasmid#246933Purposefor HEK293T human cell genome editingDepositorInsertLaTranC sgRNA
UseCRISPRAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW306_U6-sgRNA-EMX1
Plasmid#244824PurposeMammalian expression of SpyCas9 single guide RNA targeting EMX1DepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKMW493_U6-sgRNA-entry
Plasmid#244823PurposeMammalian expression of SpyCas9 single guide RNA with Golden Gate-compatible sgRNA spacerDepositorInsertSpyCas9 single guide RNA
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPP21 (pAVA3259)
Plasmid#239327PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPP21DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPP21 (RPP21 Human)
UseCRISPR and LentiviralAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only