We narrowed to 28,607 results for: grna
-
Plasmid#84881PurposeEmpty concatmer vector in which 4 gRNAs can be insertedDepositorTypeEmpty backboneUseRetroviralExpressionMammalianAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pADH139
Plasmid#90987PurposeNAT-marked "empty" gRNA construct for use in gRNA expression cassette stitching PCR; use with pADH110 to generate target-specific part 2 of 2 for C.mal LEUpOUT CRISPR system.DepositorInsertgRNA conserved, C, mal LEU2 2 of 2
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 6
Plasmid#51765PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 6
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
OA-1055J
Plasmid#200251PurposepBac-U6-gRNA(Intersex)-3xp3-tdTomatoDepositorInsert2 gRNAs targeting Intersex gene
ExpressionInsectAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-L3US2-RFP-HDAC3
Plasmid#83966PurposeLentiviral CRISPR HDAC3 dual gRNA targeting vectorDepositorAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgPBRM1-2- LentiCRISPRv2
Plasmid#107404PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
hCtRNA_FT
Plasmid#186715PurposeFragment template for DAP arrayDepositorInsertgRNA scaffold and hCtRNA
UseCRISPRExpressionMammalianPromoterhCtRNAAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR_eGFP_497
Plasmid#111824PurposeKnockout eGFPDepositorInsertgRNA targeting eGFP 477-497
UseCRISPRTagsmCherryExpressionBacterial and MammalianPromoterU6Available SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
Icam 2 SaCas9 YAP sgRNA3
Plasmid#99736PurposeExpresses SaCas9 and a gRNA targeting mouse YAPDepositorAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Suz12-F2-GFP
Plasmid#91882PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Suz12DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 3
Plasmid#51762PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 3
UseCRISPR and LentiviralExpressionMammalianPromoterEFS and U6Available SinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKdm6a#2/Cre
Plasmid#173638PurposeExpresses a Kdm6a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kdm6a (Kdm6a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKdm6a#1/Cre
Plasmid#173637PurposeExpresses a Kdm6a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kdm6a (Kdm6a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUDP046
Plasmid#107062PurposeBroad-host-range Cas9/gRNA co-expression plasmid with gRNA targetting KU80 from Ogataea parapolymorphaDepositorInsertHH-gRNA-HDV targetting OpKU80 inO. parapolymorpha
ExpressionYeastPromoterScTDH3Available SinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHX_gRNA_hPAX7_6-9S
Plasmid#160453PurposesgRNA targeting human PAX7 3' UTR with 17bp spacerDepositorInsertgRNA_hPAX7_6-9S
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM6A_2
Plasmid#86308PurposeEncodes gRNA for 3' target of human KDM6ADepositorInsertgRNA against KDM6A (KDM6A Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCB036 FoMV-sgGFP
Plasmid#234813PurposeTo express gRNA from Foxtail Mosaic Virus Vector targeting GFP (T-DNA)DepositorInsertgRNA targeting GFP
ExpressionPlantAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -