We narrowed to 17,425 results for: emb
-
Plasmid#218244Purpose1) Ectopic expression of MAAP2 protein in mammalian cells. 2) Packaging MAAP2 sequence into lentivirus for stable expression in mammalian cells.DepositorInsertMembrane-Associated Accessory Protein from Adeno-Associated Virus 2 driven by CMV promoter
UseLentiviralPromoterCMVAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
5_T7-GAP43-mScarlet3
Plasmid#225932PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the GAP43 membrane localisation signalDepositorInsertGAP43-mScarlet3
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
GST PTBP1 isoform 4
Plasmid#108594PurposeRecombinant GST tagged protein productionDepositorInsertPTBP1 isoform 4 (PTBP1 Human)
TagsGSTExpressionBacterialMutationisoform 4 (isoform a)PromotertacAvailable SinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQFlag-USP7 CS puroR
Plasmid#46752PurposeRetroviral vector that expresses catalytically inactive form of Flag-tagged human USP7DepositorInsertUSP7 (USP7 Human)
UseRetroviralTagsFlagExpressionMammalianMutationC223S--catalytically inactivePromoterCMVAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-CHC17KDP
Plasmid#59799PurposeExpresses knockdown-proof human CHC17 tagged with GFP.DepositorInsertCHC17 (CLTC Human)
TagsGFPExpressionMammalianMutationSilent mutations in amino acids 61-65 to confer s…PromoterCMVAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
PP_071_pAAV_CAG_DIO-LR-Voltron2-P2A-LR-CheRiff-TS-eYFP-ER2
Plasmid#203229PurposeCre-dependent version of PP_070. Co-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertCre-dependent, membrane-localized Optopatch
UseAAVExpressionMammalianPromoterCAGAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQHA-USP7 WT puroR
Plasmid#46753PurposeRetroviral vector that expresses wild type HA-tagged human USP7DepositorAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-HA-p53 2KR
Plasmid#78799PurposeTo overexpress p53 2KR in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQHA-USP7 CS puroR
Plasmid#46754PurposeRetroviral vector that expresses catalytically inactive form of HA-tagged human USP7DepositorInsertUSP7 (USP7 Human)
UseRetroviralTagsHAExpressionMammalianMutationC223S--catalytically inactivePromoterCMVAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-CHAMP1
Plasmid#159892PurposeExpresses CHAMP1 (CAMP) in mammalian cellsDepositorAvailable SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-Strep/HA-UBE2J1
Plasmid#124669PurposeExpresses UBE2J1 with N-terminal Strep-HA tag in mammalian cellsDepositorAvailable SinceSept. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
TagBFP2-INPP4B-CAAX
Plasmid#116857Purposeplasma membrane-targetted PI(3,4)P2 4-phosphataseDepositorAvailable SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP-shTACC3
Plasmid#59356PurposeKnocks down endogenous TACC3 and re-expresses knockdown-proof (RNAi-resistant) GFP-tagged human TACC3.DepositorInsertTransforming Acidic Coiled Coil protein 3 (TACC3 Human)
UseRNAiTagsGFPExpressionMammalianMutationSilent mutations in amino acids 30-33 to confer s…PromoterCMVAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-CRY2-mCh-superPLDx100-P2A-CIBN-CAAX
Plasmid#188994PurposeA plasmid for dual expression of CRY2-mCh-superPLDx100 (an engineered PLD mutant with 100 times higher activity than the wild-type) and plasma membrane-tagged CIBNDepositorInsertPLD
TagsCAAX, CIBN, CRY2, P2A, and mCherryExpressionMammalianMutationK57R, A59V, K109R, P245A, V264I, G328S, G381V, G4…PromoterCMVAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
OMM-long-CFAST10
Plasmid#233598PurposeExpression of CFAST10 on the OMM membrane after a long linkerDepositorInsertCFAST10
ExpressionMammalianPromoterCMVAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
1_T7-mScarlet3-Hras
Plasmid#225928PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the H-Ras membrane localisation signalDepositorInsertmScarlet3-HRas
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC-mCh-P2A-ST-EGFP-CAAX
Plasmid#207636PurposeA plasmid encoding photocaged SpyCatcher (pSC) fused to mCherry and a SpyTag-EGFP localized to the cell membrane via CAAX tagDepositorInsertphotocaged SpyCatcher-mCh-P2A-SpyTag-EGFP-CAAX
ExpressionMammalianMutationAmber stop codon at SpyCatcher’s critical lysinePromoterCMVAvailable SinceOct. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp2-P2AT2A-EGFP-caax
Plasmid#190153PurposeExpresses dominant-negative Vamp2 (mouse Vamp2 AA 1-94) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp2 (Vamp2 Mouse)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only AA #1-94PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSP64-hKCNQ1
Plasmid#53048PurposeExpresses alpha subunit for hKCNQ1 channel in Xenopus oocytesDepositorInsertPotassium voltage-gated channel subfamily KQT member 1 (KCNQ1 Human)
UseXenopus oocyte expressionPromoterSP6Available SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only