We narrowed to 2,494 results for: pcas9
-
Plasmid#198550PurposeExpresses human codon-optimized SpCas9-NRCH-SsAPOBEC3B and blasticidin resistance: EFS promoter-SpCas9-NRCH-SsAPOBEC3B-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-NRCH-SsAPOBEC3B
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianPromoterEFSAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG
Plasmid#79877PurposeFLAGless construct expressing high specificity eSpCas9(1.1). Px330-like plasmid.DepositorTypeEmpty backboneUseCRISPRTagsUntagged eSpCas9(1.1)ExpressionMammalianPromoterCBhAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-deSpCas9
Plasmid#92114PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity eSpCas9 (1.1) (without U6-sgRNA coding sequence)DepositorInsertdead/inactive eSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840A, K848A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-spCas9-pNeo
Plasmid#214120PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertspCas9
UseCRISPRExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceFeb. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
G1397 DddAtox-N–dSpCas9
Plasmid#157835Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLS–G1397 DddAtox-N–dSpCas9–UGI–UGI–bpNLS
UseCRISPRAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
P823_eSpCas9(1.1)-RecA
Plasmid#87264PurposeHuman codon optimized RecA protein was fused to eSpCas9(1.1) for enhanced genome editing efficiencyDepositorInsertRecA
TagsFLAGExpressionMammalianPromoterCBhAvailable SinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Hyg
Plasmid#232095PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-TUBB
Plasmid#66942PurposeCRISPaint target selector TUBBDepositorInsertgRNA TUBB
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pFREE2-SpCas9-sgRNA
Plasmid#179582PurposeExpresses spCas9 and gRNA that targets ColE1 plasmids for curingDepositorInsertCas9
ExpressionBacterialAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
G1333 DddAtox-N–dSpCas9
Plasmid#157833Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLS–G1333 DddAtox-N–dSpCas9–UGI–UGI–bpNLS
ExpressionMammalianAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTrex-b-NLS-hSpCas9
Plasmid#62543PurposeExpression of Cas9 in T. cruziDepositorInsertNLS-hSpCas9
UseCRISPR; Trypanosoma cruzi expressionTags3xFLAG and NLSPromoterRibo-HX1Available SinceApril 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-NL-DHFR-SpCas9
Plasmid#124522PurposeExpresses SpCas9 fused to DHFR domains on both the N-terminus and an internal loop in mammalian cellsDepositorInsertNL-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianPromoterCbhAvailable SinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-ACTG1
Plasmid#66943PurposeCRISPaint target selector ACTG1DepositorInsertgRNA ACTG1
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCas9-beta-mmr
Plasmid#169241PurposeCas9, beta, and mutL mutant expression plasmid for introducing chromosomal point mutationsDepositorInsertscas9
beta
mutL-E36K
UseCRISPR and Synthetic BiologyExpressionBacterialMutationChanged glutamic acid 36 to lysineAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-puro-a5 guide B
Plasmid#194011PurposeFor CRISPR knockout of integrin alpha5DepositorInsertsingle-guide RNA (a5_guide B)
UseCRISPRAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only