We narrowed to 16,167 results for: grna
-
Plasmid#110737PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCDKN2A gRNA (CDKN2A Human)
UseCRISPRExpressionMammalianAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEN35-CDKN2A-Ex2-L
Plasmid#110736PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCDKN2A gRNA (CDKN2A Human)
UseCRISPRExpressionMammalianAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PINK1 gRNA (BRDN0001145357)
Plasmid#78036Purpose3rd generation lentiviral gRNA plasmid targeting human PINK1DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKDC gRNA (BRDN0001149021)
Plasmid#77864Purpose3rd generation lentiviral gRNA plasmid targeting human PRKDCDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
MLKL gRNA (BRDN0001148608)
Plasmid#77539Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BRD4 gRNA (BRDN0001147320)
Plasmid#77344Purpose3rd generation lentiviral gRNA plasmid targeting human BRD4DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AKT3 gRNA (BRDN0001146868)
Plasmid#76217Purpose3rd generation lentiviral gRNA plasmid targeting human AKT3DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK11 gRNA (BRDN0001146880)
Plasmid#75912Purpose3rd generation lentiviral gRNA plasmid targeting human STK11DepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSgRNA
UseCRISPRAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Cas9-GFP_sg_mTfeb
Plasmid#79006PurposeExpresses WT Cas9 and GFP, along with a sgRNA to mouse Tfeb.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgTfeb (Tfeb Mouse)
UseCRISPRExpressionMammalianPromoterU6Available sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133C
Plasmid#69286PurposeGolden Gate entry vector; 1st gRNA under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYPQ141B
Plasmid#69291PurposeGateway entry vector; single gRNA under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceSept. 14, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
BRCA1 A9.2 gRNA
Plasmid#90548Purpose3rd generation lentiviral gRNA plasmid targeting human BRCA1DepositorInsertBRCA1 (Guide Designation A9.2)
UseCRISPR and LentiviralPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pORANGE_NFL linker(A6TAG)-3xFLAG KI
Plasmid#182680PurposeExpression of spCas9, gRNA targeting the end of mouse Nefl gene and donor linker(A6TAG)-3xFLAG. Can be used for amber codon suppression and click chemistry labeling of endogenous NFL.DepositorInsertNefl-targeting gRNA and linker(A6TAG)-3xFLAG donor sequence (Nefl Mouse)
ExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–T1gRNA
Plasmid#62717Purposet1 gRNA (ATGAGAATCAAGGCGGTCGA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9–mKate2ps
ExpressionMammalianAvailable sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
bRA90
Plasmid#100951PurposeCas9 driven by PGK1 promoter. gRNA can be cloned into the BplI sites. LEU2 markerDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJYS2cm_crtYf
Plasmid#85543PurposeConstitutive transcription of crRNA of crtYf, Chloramphenicol resistanceDepositorInsertcrRNA of crtYf
UseCRISPR; Shuttle vector corynebacterium glutamicum…ExpressionBacterialAvailable sinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
MT-AvrXa10-FT
Plasmid#234373PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-GFP-AvrXa10-GB1) with optimized activation domain (AvrXa10), targeting Arabidopsis FT locusDepositorInsertsNbGP41-GFP-AvrXa10-GB1
dCas9-24XGP41
gRNAs targeting FT locus
RFP
UseSynthetic BiologyTagsGB1, GFP, and GP41ExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and Arabidopsi…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-Puro-U6-gRNA-pA plasmid
Plasmid#247671PurposespCas9 gRNA is driven by human U6 promoter, with the gRNA cassette between PuroR and pA, making it detectable in polyA-based RNA-seq.DepositorInsertPuromycin resistant gene
ExpressionMammalianPromoterTK promoterAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MLKL gRNA (BRDN0001146456)
Plasmid#77540Purpose3rd generation lentiviral gRNA plasmid targeting human MLKLDepositorAvailable sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only