We narrowed to 11,272 results for: cat.1
-
Plasmid#14715PurposeBeta-catenin reporter - 3rd generation self-inactivating lentiviral plasmid LEF-1/TCF-responsive promoter driven d2-eGFP (destabilized, half-life of 2h).DepositorAvailable SinceAug. 28, 2009AvailabilityAcademic Institutions and Nonprofits only
-
CMV-ER-LAR-GECO1
Plasmid#61244PurposeExpresses LAR-GECO1 in the endoplasmic reticulum in mammalian cellsDepositorInsertLAR-GECO1
TagsER-retention sequence: KDEL and ER-targeting sequ…ExpressionMammalianMutationSubstitutions relative to R-GECO1: V51W/I113V/N35…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-mito-LAR-GECO1.2
Plasmid#61245PurposeExpresses LAR-GECO1.2 in the mitochondria in mammalian cellsDepositorInsertLAR-GECO1.2
Tagsa duplex of the mitochondrial targeting signal of…ExpressionMammalianMutationSubstitutions relative to R-GECO1.2: N45I/A47R/E1…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pECE HA AMPKa1 WT
Plasmid#69504PurposeExpresses AMPK alpha1 in mammalian cellsDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-1 (PRKAA1 Human)
UseRetroviralTagsHAExpressionMammalianPromoterSV40 early promoterAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhAC T2A tDimer
Plasmid#101722Purpose- humanized - variant of pAAV hSyn YFP-CaRhAC Addgene # 101721– less reliable in hippocampal neuronsDepositorInsertsCatRhAC
red fluorescent protein
UseAAVMutationE497K,C569DPromoterhuman Synapsin1 promotor and ribosomal skip seque…Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
bu6-sgCebpa_v2-mU6-sgCebpb_v2-hU6-sgCebpd_v2
Plasmid#177258PurposeExpresses Cebpa_v2 (bU6), Cebpb_v2 (mU6), Cebpd_v2 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgCebpa_v2/sgCebpb_v2/sgCebpd_v2
UseLentiviralPromoterbU6/mU6/hU6Available SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF1368
Plasmid#143793PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2750
Plasmid#144226PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1367
Plasmid#143492PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1652
Plasmid#143532PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1653
Plasmid#143533PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET21a-TEX264-deltaLRR-His6
Plasmid#220215PurposeBacterial expression of TEX264, 2-25 residues (LRR) truncated, C-terminal His6 tagDepositorInsertTEX264 (TEX264 Human)
TagsHis6ExpressionBacterialMutationc.4-75del / p.2-24delPromoterT7Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF1369
Plasmid#143794PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1005
Plasmid#143898PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1004
Plasmid#142248PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF0465
Plasmid#143218PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTag-RFP-C-h-Rab11a
Plasmid#79806PurposeExpress TagRFP labeled human Rab11a (GTPase located on recycling endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTag-BFP-C-h-Rab11a
Plasmid#79805PurposeExpress TagBFP labeled human Rab11a (GTPase located on recycling endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDF_AtRaf1/Raf2/BSD2
Plasmid#229511PurposeExpresses Arabidopsis thaliana chaperones: Raf1,Raf2,BSD2DepositorInsertsExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only