We narrowed to 3,237 results for: sam
-
Plasmid#229019PurposeExpression of untagged full length human LRRK2 in mammalian cellsDepositorInsertLeucine-rich repeat kinase 2 (LRRK2 Human)
Tagsno tags (untagged)ExpressionMammalianMutationnonePromoterCMVAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Kif2c
Plasmid#208651PurposeMammalian expression plasmid expressing eGFP-Kif2c driven by CMV promoterDepositorAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-dnMCAK
Plasmid#208650PurposeMammalian expression plasmid expressing eGFP-dnMCAK driven by CMV promoterDepositorInsertKif2c (Kif2c Cricetulus griseus (Chinese hamster))
TagseGFPExpressionMammalianMutationS92A , S106A , S108A, S112A , S186A, H530A, R534A…Available SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE
Plasmid#159630PurposeAAV expression of HA Allatostatin-3, neurophysin, IRES mCherry under the CAG promoterDepositorInsertAst (AstA Fly)
UseAAVTagsHA, IRES, mCherry, and neurophysin-1ExpressionMammalianPromoterDCA (same as CAG promoter)Available SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-IRES-Td
Plasmid#176298PurposeExpresses DCK* and TdTomato from the same transcriptDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLEX307 hDVL1
Plasmid#102863PurposeExpresses human DVL1 in mammalian cellsDepositorInserthuman Dishevelled 1 (DVL1) (DVL1 Human)
UseLentiviralExpressionMammalianMutationChanged alanine 2 to glycine. Likely due to poly…PromoterEF1AAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NAGK
Plasmid#23785DepositorInsertNAGK (NAGK Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
6MIW
Plasmid#127291PurposeBacterial expression for structure determination. May not contain entire coding region of geneDepositorAvailable SinceJune 18, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pKK-BI16-FLAG-3C-ORF1_mClover3-TEV-ORF2
Plasmid#105801PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C or enterokinase; second protein expressed with mClover3, cleavable by TEV protease; tags positions: N-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: FLAG-3C; ORF2: mClover3-TEVExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Venus
Plasmid#105805PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Venus, cleavable by TEV. Useful for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-VenusExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-ORF1-3C-FLAG_ORF2-TEV-mClover3
Plasmid#105803PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C protease; second protein expressed with mClover3, cleavable by TEV protease; tags positions: C-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-FLAG; ORF2: TEV-mClover3ExpressionMammalianAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Amber
Plasmid#105806PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Amber, cleavable by TEV. Control for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-AmberExpressionMammalianAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-ER WPRE
Plasmid#236230PurposeAAV expression of a fluorescent marker, mEmerald fused to Prolactin signal peptide and KDEL sequence; for expression and retention in the lumen of the endoplasmic reticulumDepositorInsertmEmerald-PRL signal peptide-KDEL sequence (PRL Bovine)
UseAAVTagsmEmeraldPromoterhuman Synapsin 1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON HaloTag-Sec61b WPRE
Plasmid#236229PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to HaloTagDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV KI Cloning Vector_hSyn mTagBFP2-CAAX2
Plasmid#236245PurposeCloning template for knock-in based strategy with U6 promoter, gRNA and donor tag cloning cassettes, and a fluorescent marker for the plasma membrane under hSyn promoterDepositorInsertmTagBFP2 fused to the plasma membrane targeting sequence CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-Sec61b WPRE
Plasmid#236228PurposeAAV expression of a marker for the endoplasmic reticulum, Sec61b, fused to mEmerald.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CLMP-COMP5AP-AviTag-9xHis
Plasmid#157209PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only