We narrowed to 3,472 results for: cmv promoter
-
Plasmid#177911PurposeFRB-tTA-Myc tagDepositorInsertFRB-tTA
TagsMyc tagExpressionMammalianPromoterCMV promoterAvailable SinceJan. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
Beclin-1-HiBiT Vector (CMV)
Plasmid#236899PurposeExpress Beclin-1-HiBiT in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertBeclin (BECN1 Human)
TagsHiBiTExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
HiBiT-Beclin-1 Vector (CMV)
Plasmid#236900PurposeExpress HiBiT-Beclin-1 in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertBeclin (BECN1 Human)
TagsHiBiTExpressionMammalianMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDsRed1-CMV-Rat Nurr1-DsRed1-pA
Plasmid#233275PurposeTo Express a Rat Nurr1-DsRed fusion protein from a CMV promoterDepositorAvailable SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-218_HNF4A2
Plasmid#31090DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
CMV-138_HNF4A8
Plasmid#31093DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 8 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
CMV-68_HNF4A2
Plasmid#31092DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
CMV-138_HNF4A2
Plasmid#31091DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsmycExpressionMammalianMutationsplice variant 2 of HNF4A, deletion of CMV promo…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
EW267 CMV-TO-ADAR2dd(E488Q, T501A)-PUF-9R-MARIAcomp(V241D, H243M) (FLP-IN)
Plasmid#236127PurposePlasmid encoding ADAR2dd attached to PUF-9R with deimmunizing mutations under control of CMV promoter with two TetR binding sitesDepositorInsertADAR2dd-PUF-9R (ADARB1 Synthetic, Human)
ExpressionMammalianMutationE488Q, T501A in ADAR2dd; V241D, H243M in PUF-9RPromoterCMV promoter with two TetR binding sitesAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-PtenK13E/K289E-Puro
Plasmid#135681PurposeConstitutive expression (cMV promoter) of K13E/K289E mutant Pten cDNA, Puromycin selectionDepositorAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV-Blast
Plasmid#125133PurposeLentiviral empty backbone control vector with CMV promoter and Blasticidin resistance geneDepositorTypeEmpty backboneUseLentiviralAvailable SinceMay 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_EGFP
Plasmid#134984PurposeThe plasmid includes a EGFP gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertEGFP
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHCMV_SARS-CoV_S
Plasmid#207306PurposeMammalian expression of Human SARS coronavirus S proteinDepositorInsertSARS-CoV_S (S Human SARS coronavirus)
ExpressionMammalianMutationmammalian codon optimizationPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_miRFP703
Plasmid#134985PurposeThe plasmid includes a miRFP703 gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertmiRFP703
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCCl-MCS_miniCMV_TagBFP
Plasmid#134986PurposeThe plasmid includes a TagBFP gene driven by a minimal CMV promoter. Cis-regulatory elements can be cloned into the single EcoRV site. This plasmid can be used for generating a lentiviral vectorDepositorInsertTagBFP
UseLentiviralPromoterminCMVAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV_mCherry_2A_HA_2xMS2-VP64
Plasmid#68419PurposeTransient expression of humanized MS2 (V75E/A81G), fused to the VP64 transcrption activator, in mammalian cells, under a CMV promoterDepositorInsertMS2
UseSynthetic BiologyTagsHA and VP64ExpressionMammalianMutationMS2: V75E/A81GPromoterCMVAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
lvl0-P-CMV
Plasmid#229165Purposelvl 0 promoterDepositorInsertCMV
UseSynthetic BiologyAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-VSVgSS-15F11-TM
Plasmid#207317PurposeFunctional incorporation of 15F11 scFv (anti-HA) into envelope of virionsDepositorInsert15F11 ScFv
ExpressionMammalianPromoterCMV promoterAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
CMV-dCasRx-ccdB
Plasmid#221003PurposeDestination vector for Gateway cloning of ORFs into the C-terminus of dCasRx. CMV promoter. Transient expression.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::rtTA3-bGHpA
Plasmid#62445PurposeMXS_chaining vector with CMV::rtTA3-bGHpADepositorInsertcassette containing the reverse tetracycline transactivator with CMV promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::ZeoR-bGHpA
Plasmid#62441PurposeMXS_chaining vector with CMV::ZeoR-bGHpADepositorInsertresistance cassette against Zeocin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::PuroR-bGHpA
Plasmid#62439PurposeMXS_chaining vector with CMV::PuroR-bGHpADepositorInsertresistance cassette against Puromycin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::HygroR-bGHpA
Plasmid#62435PurposeMXS_chaining vector with CMV::HygroR-bGHpADepositorInsertresistance cassette against hygromycin B with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::CreERT2-bGHpA
Plasmid#62443PurposeMXS_chaining vector with CMV::CreERT2-bGHpADepositorInsertcassette containing the tamoxifen inducible Cre recombinase with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::NeoR-bGHpA
Plasmid#62437PurposeMXS_chaining vector with CMV::NeoR-bGHpADepositorInsertresistance cassette against Neomycin with CMV Promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
MXS_CMV::tTA2-bGHpA
Plasmid#62447PurposeMXS_chaining vector with CMV::tTA2-bGHpADepositorInsertcassette containing the tetracycline transactivator with CMV promoter
UseSynthetic BiologyAvailable SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV5a-p37WT-FLAG
Plasmid#225498PurposeExpression of FLAG-tagged wildtype p37 proteinDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CMV-SCLM
Plasmid#216758PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleonDepositorInsertSuperClomeleon followed by WPRE and human growth hormone polyA terminator
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCMV (cytomegalovirus)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase-recruited click editor - pCMV-T7-PCV2-nCas9-CC(N6) (LM2705)
Plasmid#208962PurposePolymerase-recruited click editor comprised of PCV2 fused to nCas9 with a C-terminal N6 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-CC(N6)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only