We narrowed to 9,450 results for: tre promoter
-
Plasmid#146840PurposeInsect Expression of DmGW182-SD6B-dsRNAresDepositorInsertDmGW182-SD6B-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182-V958PQ959P-dsRNAres_L
Plasmid#146842PurposeInsect Expression of DmGW182-V958PQ959P-dsRNAresDepositorInsertDmGW182-V958PQ959P-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182_1-1199-dsRNAres_L
Plasmid#146822PurposeInsect Expression of DmGW182_1-1199-dsRNAresDepositorInsertDmGW182_1-1199-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182-delDUF-dsRNAres_L
Plasmid#146829PurposeInsect Expression of DmGW182-delDUF-dsRNAresDepositorInsertDmGW182-delDUF-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182-E962Q-dsRNAres_L
Plasmid#146834PurposeInsect Expression of DmGW182-E962Q-dsRNAresDepositorInsertDmGW182-E962Q-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182-F961A-dsRNAres_L
Plasmid#146835PurposeInsect Expression of DmGW182-F961A-dsRNAresDepositorInsertDmGW182-F961A-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-DmGW182-PAM26B-dsRNAres_L
Plasmid#146837PurposeInsect Expression of DmGW182-PAM26B-dsRNAresDepositorInsertDmGW182-PAM26B-dsRNAres (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1A
Plasmid#65371PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorInsertBAZ1A (BAZ1A Human)
TagsEmGFP and V5ExpressionMammalianMutation796I compared to all reference sequencesPromoterCMVAvailable SinceJune 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB-CuO-V5 CASC3 siRes1+2 f.l. WT
Plasmid#158540PurposeFor PiggyBac-mediated integration of V5-tagged siRNA-resistant full-length CASC3DepositorAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-GCN5
Plasmid#65386PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV.tetO.Ascl1.U6.shRest1.U6.shRest2
Plasmid#234846Purpose3rd generation lentiviral vector, expresses Ascl1 under control of TetON promoter and two shREST sequences under control of U6 promotersDepositorAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 KBTBD4 WT
Plasmid#184627PurposeMammalian expression vector with N-terminal 3xFlag for KBTBD4 WT expression in mammalian cellsDepositorInsertN-terminal 3xFlag tagged KBTBD4 WT (KBTBD4 Human)
ExpressionMammalianMutationno mutationPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-HIF2α P405A Δ450-572-pBabe-Puro
Plasmid#25958DepositorInsertHypoxia inducible factor 2 alpha (EPAS1 Human)
UseRetroviralTagsHA-tagExpressionMammalianMutationcDNA changed amino acids: Proline 405 to Alanin…Available SinceSept. 20, 2010AvailabilityAcademic Institutions and Nonprofits only -
p2K7bsdUBI-mCherry-STIM1
Plasmid#114178PurposeLentiviral vector for expression of mCherry-STIM1DepositorInsertSTIM1 (STIM1 Human)
UseLentiviralTagsmCherry (inserted after signal peptide)ExpressionMammalianPromoterUbiquitinAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HNF1A-WT-Flag-UTR
Plasmid#183237PurposeExpression of FLAG tagged HNF1ADepositorAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR-XL-rAkap9
Plasmid#196867PurposeCloned rat (r) A-Kinase Anchoring Protein 9 (Akap9) ORF. Used as a template for Akap9 containing constructsDepositorAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIRIGF-IKZF1-V2
Plasmid#69045Purposeexpression of IKZF1 fused to firefly luciferase with co-expression of Renilla luciferase, both under IRES control.DepositorInsertIKZF1 (IKZF1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationsplice variant 2PromoterIRESAvailable SinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR1a-mCherry-STIM1
Plasmid#114176PurposeGateway entry clone containing mCherry-STIM1DepositorAvailable SinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits only