We narrowed to 6,006 results for: actin
-
Plasmid#162485PurposeFor generating transgenic mice expressing ROCK biosensor based on FRET.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertROCK biosensor based on FRET.
TagsYPet and ECFPExpressionMammalianPromoterCAGAvailable sinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pROSA26-FlpERT2
Plasmid#149438PurposeROSA26 mouse targeting vector with tamoxifen-inducible Flp recombinaseDepositorInsertFlp-ERT2 fusion protein
UseCre/Lox and Mouse TargetingTagsERT2ExpressionMammalianPromoterCAG promoterAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Double UP mNeon to mScarlet FRT
Plasmid#141111PurposeNatively produces mNeonGreen, in the presence of Flp or Flpe will be recombined to produce mScarlet.DepositorTypeEmpty backboneExpressionMammalianPromoterCAGAvailable sinceJuly 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG/Luci
Plasmid#139981PurposeExpresses luciferase under the promoter of CAG. Transgene flanked by AAV2 ITRDepositorInsertLuciferase
UseAAVPromoterCAGAvailable sinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hCjeCas9-NLS(SV40)-3xFLAG (KAC579)
Plasmid#133789PurposeCAG promoter expression plasmid for human codon optimized CjeCas9 nuclease with C-terminal NLS (SV40)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized CjeCas9
TagsNLS(SV40)-3xFLAGExpressionMammalianMutationn/aPromoterCAGAvailable sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCX-SponGee-Kras
Plasmid#134777Purposemammalian expression of SponGee-Kras, a plasma membrane-targeted but lipid raft-excluded variant of the cGMP buffer SponGee that prevents downstream signalingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSponGee-Kras
TagsFLAG and mRFPExpressionMammalianPromoterCAGAvailable sinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hA3A-BE3 (pRZ215)
Plasmid#131314PurposeCAG promoter expression plasmid for hA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthA3A-XTEN linker-hSpCas9n(D10A)-UGI-NLS-P2A-EGFP
ExpressionMammalianPromoterCAGAvailable sinceOct. 24, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-CAG-NOTCH2NLB (N2NL-FL)-ires-EGFP
Plasmid#122954PurposeLentiviral expression of NOTCH2NLB full length under CAG promoter with EGFP expressionDepositorAvailable sinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA1158_pPBCAG-MerCreMer-IZ
Plasmid#124184PurposepiggyBac-based expression of the tamoxifen-inducible CreDepositorInsertMerCreMer-IRES-Zeo
ExpressionMammalianPromoterCAGAvailable sinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai167 (TIT2L-ChrimsonR-tdT-ICL-tTA2) targeting vector
Plasmid#114431PurposeTarget a Cre-dependent ChrimsonR-tdTomato cassette and a tTA2 cassette into the mouse TIGRE locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertChrimsonR-tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eArch3.0-mRuby2-ST
Plasmid#109135PurposeArchaerhodopsin fused to mRuby2 and targeted to the neuronal soma and proximal dendritesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserteArch3.0-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CoChR-mRuby2-ST
Plasmid#109131PurposeCation channelrhodopsin CoChR fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCoChR-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Archon2-KGC-EGFP-ER2
Plasmid#108421PurposeAAV production plasmid encoding for Archon2 fluorescent voltage reporterDepositorInsertArchon2-KGC-EGFP-ER2
UseAAVExpressionMammalianPromoterCAGAvailable sinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eGFP-pA
Plasmid#107281Purposedonor vector backbone with constitutive eGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGFP
ExpressionMammalianPromoterCAGAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPBC-G6f
Plasmid#62811PurposepPBC-G6f expresses PiggyBac inverted terminal repeat-flanked GCaMP6f under the control of the CAG promoter.DepositorInsertITR-CAG-GCaMP6f-ITR
ExpressionBacterial and MammalianPromoterCAGAvailable sinceMay 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-Nanog-pA-pgk-hph
Plasmid#74915PurposeMammalian expression of mNanogDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNanog (Nanog Mouse)
ExpressionMammalianPromoterCAGAvailable sinceMay 17, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPB-CAG-Flag3-pG-mNanog-pgk-hph
Plasmid#74911PurposeMammalian expression of Flag tagged mNanogDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNanog (Nanog Mouse)
Tags3xFlagExpressionMammalianPromoterCAGAvailable sinceMay 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
R26TV LSL-TRL
Plasmid#68476PurposeRosa26 targeting vector expressing Cre-dependent tTR-KRAB-rtTA3-Luc cassetteDepositorInserttTR-KRAB-2A-rtTA3-2A-Luciferase
UseCre/Lox, Luciferase, and Mouse TargetingExpressionMammalianPromoterCAGAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only