We narrowed to 42,317 results for: lat
-
Plasmid#190855PurposeFor mammalian expression of 3JB8R+12, a dual-specificity aptamer that binds OGT and β-catenin. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB8R_bc339+12bp (A Dual-Specificity aptamer targeting OGT and β-catenin)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-NL1F30
Plasmid#190829PurposeFor mammalian expression of NL1F30, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL1F30 (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F
Plasmid#190832PurposeFor mammalian expression of 3JB1F, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F+4
Plasmid#190834PurposeFor mammalian expression of 3JB1F+4, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+4bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F+8
Plasmid#190836PurposeFor mammalian expression of 3JB1F+8, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+8bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F+10
Plasmid#190837PurposeFor mammalian expression of 3JB1F+10, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+10bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F+12
Plasmid#190838PurposeFor mammalian expression of 3JB1F+12, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+12bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1R
Plasmid#190839PurposeFor mammalian expression of 3JB1R, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1R (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1R+2
Plasmid#190840PurposeFor mammalian expression of 3JB1R+2, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1R_AP3+2bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pXD70Tet(DadRmt4)-DadR(linker)
Plasmid#191639PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), dadR(linker region shuffled) complementationDepositorInsertDadR
ExpressionBacterialMutationLinker region sequence shuffledAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadR-NFLAG)-N-3xFLAG-DadR
Plasmid#191640PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), N-3xFLAG-dadR complementationDepositorInsertDadR
Tags3xFLAGExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadRmt5)-N-3xFLAG-DadR(ΔDBD)
Plasmid#191641PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), N-3xFLAG-dadR(ΔDBD) complementationDepositorInsertDadR
Tags3xFLAGExpressionBacterialMutationΔDBDAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadRmt6)-N-3xFLAG-DadR(ΔTM)
Plasmid#191642PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), N-3xFLAG-dadR(ΔTM) complementationDepositorInsertDadR
Tags3xFLAGExpressionBacterialMutationΔTMAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadRmt7)-N-3xFLAG-DadR(linker)
Plasmid#191643PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), N-3xFLAG-dadR(linker region shuffled) complementationDepositorInsertDadR
Tags3xFLAGExpressionBacterialMutationLinker region sequence shuffledAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pXD70Tet(DadH)-Pdadh-DadhABC(A2)
Plasmid#191644PurposeE. coli - Eggerthella lenta shuttle plasmid (TetR), native promoter-dopamine dehydroxylase from dopamine-metabolizing E. lenta A2 strainDepositorInsertDopamine dehydroxylase
ExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBSKΔB-24xopto-TetO-no01
Plasmid#174887PurposePlasmid vector containing southern blot probe for opto-TetO in STREAMING-tagDepositorInsert24xopto-TetO
UseSouthern blot probeAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT002
Plasmid#182712PurposeaTc inducible dCasRx-IF1DepositorInsertdCasRx
UseCRISPRTags3x(GGGS)-Escherichia Coli Initiation Factor 1ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpTetAvailable SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
2Bc-T MBP_BoMoC(ed)_W403A_6xH
Plasmid#185712PurposeRecombinant B. mori truncated R2 RT expressionDepositorInsertB. mori truncated R2 RT
Tags6xHis and MBPExpressionBacterialMutationChanged W403 to APromoterT7Available SinceAug. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSIIpuro-miRFP670-eDHFR(69K6)
Plasmid#178852PurposeMammalian expression of miRFP670-eDHFR(69K6)DepositorInsertmiRFP670-eDHFR(69K6)
UseLentiviralExpressionMammalianPromoterEF1-alphaAvailable SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only