We narrowed to 9,450 results for: tre promoter
-
Plasmid#108499Purposeexpression of vsv-CenpB 1-166-Sgo1 N61I-EGFP (no PP2A binding)DepositorInsertCenpB-Shugoshin 1 (SGO1 Human)
TagsEGFP and VSVExpressionMammalianMutationCenpB 1-166 fusion before Sgo1, no PP2A binding N…PromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Neuroserpin oloop
Plasmid#58260PurposeRetroviral vector for expressing mutated Neuroserpin in mammalian cellsDepositorInsertNeuroserpin (SERPINI1 Human)
UseRetroviralExpressionMammalianMutationMutant of neuroserpin lacking five residues from …Available SinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJL308
Plasmid#243704PurposeA piggyBac vector containing the NDUFB9 coding sequence under the control of its endogenous promoter and 5' UTR, followed by the ACTB 3' UTRDepositorInsertNDUFB9 coding sequence with endogenous 5' UTR, followed by the ACTB 3' UTR (NDUFB9 Human)
ExpressionMammalianPromoterendogenous promoterAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mVenus-rRim1[20-227]-mVenus(L68V)
Plasmid#246280PurposeRab10 sensor acceptorDepositorAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET SUMO-syt7 (136-403) L361C
Plasmid#213622PurposeBacterial expression of SUMO-tagged mouse syt7 (136-403) L361CDepositorAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET SUMO-cPLA2 C2 domain (Y96C)
Plasmid#213633PurposeBacterial expression of SUMO-tagged human cPLA2 C2 domain (Y96C)DepositorInsertcPLA2 C2 domain (Y96C) (PLA2G4A Human)
TagsSUMOExpressionBacterialMutationY96C, C139A, C141SAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETM-41-DmPABPC1_J
Plasmid#146643PurposeBacterial Expression of DmPABPC1DepositorInsertDmPABPC1 (pAbp Fly)
ExpressionBacterialMutation4 silent mutations compared to the sequence geven…Available SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
p35S::SISOBIR1-YFPc
Plasmid#86164PurposeSOBIR1 split YFPDepositorAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
p35S::AtSOBIR1-YFPn
Plasmid#86165PurposeSOBIR1 split YFPDepositorAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM-Cas12a
Plasmid#196291Purpose35S promoter-driven expression of the positive-sense TSWV M RNA segment encoding LbCas12a in place of viral GPDepositorInsertFull length TSWV M antigenome encoding LbCas12a in place of viral GP (cas12a Synthetic)
UseCRISPRTagsFlagExpressionPlantMutationSee depositor comments belowPromoterduplicated cauliflower mosaic virus 35S promoterAvailable SinceMay 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-2
Plasmid#181871PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shNCLX-1
Plasmid#181870PurposeExpresses NCLX-targeted shRNA under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertsolute carrier 8 family member B1 (Slc8b1 Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR RPS27A K107/113R-3xFlag_IRES-GFP
Plasmid#198392PurposeRPS27A K107/113R (ubiquitin/ribosomal protein eS31 fusion) expressionDepositorInsertRPS27A (RPS27A Human)
UseLentiviralTags3xFlagExpressionMammalianMutationubiquitination site double mutant (K107/113R)PromoterEF1AAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-CRY2–mPKCε-CAT-HA
Plasmid#190483PurposeExpresses a fluorescently-tagged, optogenetically activated PKC-epsilon. Used in tandem with CIBN-CAAXDepositorInsertmCherry-CRY2–mPKCε-CAT-HA (Prkce Mouse, Synthetic)
TagsFused to CRY2, HA, and mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1 pET151
Plasmid#159384PurposeExpresses human TLNRD1 in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 (TLNRD1 Human)
TagsHis-tag, TEV cleavage siteExpressionBacterialPromoterT7Available SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUN1243 - pL0_pT3O (pro + 5U)
Plasmid#203891PurposeT3O promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertT3O promoter and 5'UTR
ExpressionPlantAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1198 - pL0_pD4H (pro + 5U)
Plasmid#203894PurposeD4H promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertD4H promoter and 5'UTR
ExpressionPlantAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFB2gRNA12
Plasmid#196106PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196107, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_SAFB2gRNA13
Plasmid#196107PurposeContains guide RNA to 3' end of mouse SAFB2 gene for safb1/2 dko. Used with Addgene IDs: 196103, 196106, 196108DepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only