We narrowed to 6,738 results for: pAAV
-
Plasmid#111581PurposeAn AAV vector that expresses double floxed myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVPromoterEf1aAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP1568 - pAAV-AiE2235m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#241537PurposeAiE2235m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceMarch 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
AiP20063 - pAAV-AiE3114m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230793PurposeAiE3114m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
AiP2105 - pAAV-AiE2638m-minBG-SYFP2-WPRE3-BGHpA
Plasmid#230551PurposeAiE2638m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-cyan pre-eGRASP(p30)
Plasmid#111583PurposeAn AAV vector that expresses double floxed cyan pre-eGRASP(p30) under the Ef1a promoter.DepositorInsertcyan pre-eGRASP(p30)
UseAAVPromoterEf1aAvailable SinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-sesRNA-smFlag-tTA2-W3SL
Plasmid#192066PurposeExpression of mCherry, sesRNA in mammalian cells, with smFlag and tTA2 as efRNA.DepositorInsertsesRNA for Mouse Ctip2
UseAAVExpressionMammalianPromoterhSynAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a DIO-rsChRmine-oScarlet-Kv2.1-WPRE
Plasmid#183529PurposeOptogeneticsDepositorInsertrsChRmine-oScarlet-Kv2.1
UseAAVMutationI146M/G174SPromoterEf1aAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-NanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp
Plasmid#125228PurposeExpresses SPARK2 NanoLuc-βarrestin2-TEVp in mammalian cellsDepositorInsertNanoLuc-15aa linker-βarrestin2-HA-GS linker-TEVp
UseAAVTagsHAExpressionMammalianPromoterCMVAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChroME-ST-P2A-H2B-mRuby3
Plasmid#108912PurposeCation channelrhodopsin ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a viral vectorDepositorHas ServiceAAV9InsertChroME-ST
UseAAVPromoterCAGAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
AiP1977 - pAAV-AiE2586m-minBG-SYFP2-WPRE-BGHpA
Plasmid#214601PurposeAiE2586m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-hChR2(H134R)-mCherry-WPRE-pA
Plasmid#37090PurposeExpresses humanized ChR2(H134R)-mCherry in cells lacking Cre (Cre-Off, flanked by alternative lox FAS sites), for optogenetic excitationDepositorInserthChr2(H134R)-mCherry
UseAAV and Cre/Lox; Cre-offTagsmCherryPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Actc1
Plasmid#99690PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG ) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLY017SB_pAAV-U6sg(BbsI)-EFS-Thy1.1-P2A-SB100X
Plasmid#192151PurposeT cell CRISPR AAV-SB vectorDepositorTypeEmpty backboneUseAAVExpressionMammalianMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Jaws-KGC-GFP-ER2]
Plasmid#108274PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterEF1α promoter (1.1kb short version)Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CCR5 gRNA (SpyCas9 scaffold)
Plasmid#113041PurposeAAV vector; encodes GFP as well as a U6-driven CCR5-targeting gRNA (SpyCas9 scaffold)DepositorInsertgRNA CCR5 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-CFTR gRNA (SpyCas9 scaffold)
Plasmid#113042PurposeAAV vector; encodes GFP as well as a U6-driven CFTR-targeting gRNA (SpyCas9 scaffold)DepositorInsertCFTR gRNA (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
Plasmid#92392Purposeproduces AAV expressing Cal-light TM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTADepositorInsertTM-CaM-NES-TEV-N-AsLOV2-TEVseq-tTA
UseAAV and Synthetic BiologyExpressionMammalianPromoterHuman SynapsinAvailable SinceJune 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
AiP1010-pAAV-mscRE4-minBGpromoter-iCre-WPRE-hGHpA
Plasmid#163476PurposeDirect-expressing iCre AAV Virus. Alias: AiP1010 - pAAV-AiE2004m-minBG-iCre-WPRE-HGHpADepositorInsertiCre
UseAAVPromoterBeta Globin minimal promoterAvailable SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RAM-d2TTA::TRE-NLS-mKate2-WPREpA
Plasmid#84474PurposepAAV-RAM-NLS-mKate2DepositorInsertmKate2
UseAAVTagsNuclear localization signal of SV40 large T antig…PromoterTREAvailable SinceDec. 14, 2016AvailabilityAcademic Institutions and Nonprofits only