We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
-
-
pQCi
Plasmid#154345PurposeSelf-Cutting and Integrating CRISPR backbone (px458 derivative with Cas9-intron, sgRNA, and bait integration sites)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL1142 (pSPIN, pBBR1 backbone)
Plasmid#160730PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA, with BsaI sites for spacer cloning. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-COX8A
Plasmid#227308PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of COX8A for knock-in.DepositorInsertsgRNA Targeting C-terminus of COX8A (COX8A Human)
UseCRISPRExpressionMammalianPromoterU67Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSB700
Plasmid#64046PurposeLentiviral vector for expressing U6 sgRNA and CAGGS Cerulean fluorescent proteinDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterU6, CAGGSAvailable SinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease
Plasmid#176528PurposeDelivers all prime editing nuclease components in a single plasmidDepositorInsertCbH-Cas9-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMBEC6
Plasmid#187598PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Gentamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBEC2
Plasmid#187596PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Kanamycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMBEC8
Plasmid#187599PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPtGE34
Plasmid#107932PurposeExpresses Cas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
UseCRISPR and Synthetic Biology; Episomal vector for…Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMCL8_28bp
Plasmid#176185Purposeplasmid containing scaffold gRNA for Cas9 followed by a 28bp Csy4 recognition sequence, RPR1p-tetO-GFP-scRNA-28bpCsy4-RPR1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only
