We narrowed to 31,681 results for: PLE
-
Plasmid#65845PurposeMammalian expression of the wild type N terminal part (N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorInsertTransmembrane (23 AA) of UQCC3 (UQCC3 Human)
TagsGFPExpressionMammalianMutationWT TransmembraneAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) neo with Smad5 CDS
Plasmid#61800PurposepcDNA3.1(+) with full length mouse Smad5 CDSDepositorInsertSmad5 CDS (Smad5 Mouse)
ExpressionMammalianAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
FLAG-FLJ20309
Plasmid#15360DepositorAvailable SinceAug. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET28b(+)-SPN+IFS
Plasmid#83372PurposeExpresses SPN and IFS complex in E. coli cellDepositorInsertsSPN
IFS
TagsHexahistidine tagExpressionBacterialPromoterT7Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTS115 pHAGE2 CMVtetO2 MCS-3C-SUMOstar-22xGS-Alfa-P2A-TagBFP
Plasmid#199368PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally 3C-SUMOstar-ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTags3C-SUMOstar-ALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
YFP-Gamma 5
Plasmid#36044DepositorAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
p3xFlag-CMV14-hISD11
Plasmid#31897DepositorAvailable SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2-Ywhag-3'UTR-MRE-3 MUT
Plasmid#61792PurposeLuciferase reporter containing the 3'UTR of mouse Ywhag with MRE-3 mutatedDepositorInsertmouse Ywhag 3'UTR with miR-200c MRE-3 mutated
UseLuciferaseMutationmiR-200c MRE-3 mutatedAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJFRC-10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
Plasmid#217514PurposeEncodes a UAS controlled and Flp dependent conditional trangene of bicistronic myrTdtomato and KD RecombinaseDepositorInsert10XUAS-FRT-STOP-FRT-myrTdtomato-2A-KDR::Pest
ExpressionInsectAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP3C-mCherry
Plasmid#210377PurposeExpresses the C terminal of SARS-CoV-2 NSP3 fused with mCherry tag in mammalian cellsDepositorInsertNSP3C (ORF1ab SARS-CoV-2)
TagsmCherryExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
NSP3C-EGFP
Plasmid#210318PurposeExpresses the C terminal of SARS-CoV-2 NSP3 fused with EGFP tag in mammalian cellsDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 N-2Strep
Plasmid#210376PurposeExpresses SARS-CoV-2 N protein fused with 2Strep in mammalian cellsDepositorAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SEC61B-2Strep
Plasmid#210375PurposeExpresses SEC61B fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-RPLP15UTR-hRluc-A60
Plasmid#182639PurposeTranscription template plasmid for RPLP1 5'UTR followed by Renilla luciferase open reading frame and polyA sequenceDepositorInsertRenilla luciferase
UseLuciferaseExpressionMammalianMutationThe transcription is driven by a T7 promoter, paiā¦Available SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIG1_UL136_19kDa_EE
Plasmid#74951PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 19kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTagsGlu-Glu tag (EYMPME)ExpressionMammalianMutationdelta 1-127PromoterCMV, lentiviral LTRAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIG1_UL136_23kDa_Myc
Plasmid#74949PurposePlasmid for mammalian expression of HCMV protein UL136. Expresses only the 23kda isoform of UL136. Also expresses EGFP.DepositorInsertUL136 (UL136 Human Cytomegalovirus strain TB40/E)
UseLentiviralTagsHA Tag (YPYDVPDYA)ExpressionMammalianMutationdelta 1-99 M128APromoterCMV, Lentiviral LTRAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(WT)
Plasmid#112720PurposeWild-type TBP6.7 was one of the first evolved TAR-binding proteins to bind with exceptional affinity. It was this protein that was used to obtain co-crystals with WT TAR RNA.DepositorInsert6His-TEV-TBP6.7(WT)
Tags6His-TEVExpressionBacterialPromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(P46A)
Plasmid#112721PurposeThis mutation (P46A) marks the first residue within the evolved region of U1A.DepositorInsert6His-TEV-TBP6.7(P46A)
Tags6His-TEVExpressionBacterialMutationP46APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only