We narrowed to 5,415 results for: mos
-
Plasmid#41723DepositorInsertHes1 Promoter (-467 to +46) (Hes1 Mouse)
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationContains the murine Hes1 promoter (-467 to +46)PromoterHes1 promoter fragment (-467 to +46)Available SinceMarch 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 SIRT7_H187Y
Plasmid#53151Purposeexpression vector for catalytically inactive human Sirtuin7DepositorInsertSirt7 (SIRT7 Human)
TagsFLAGExpressionMammalianMutationH187Y, catalytic inactivePromoterCMVAvailable SinceMay 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-ER-EBFP2
Plasmid#231183PurposeExpresses control plasmid for ER-mitochondrial linkers, tagged with EBFP2, in mammalian cellsDepositorInsertER-EBFP2
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-FastFUCCI (JDW 1494)
Plasmid#242592PurposeA CAGGS driven expression vector containing FastFUCCI to label cell cycle state.DepositorInsertmKO2-hCDT1(30-120) T2A mAG-hGEM(1-110)
ExpressionMammalianPromoterCAGGSAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-V5-n2StayGoldC4 (JDW 1354)
Plasmid#224486PurposeGateway compatible middle entry clone contianing Histone H2B fusion to V5-tagged (n2)StayGold(C4) (Nuclear StayGold fluorescent reporter)DepositorInsertH2B-V5-n2StayGoldC4
UseGateway CloningAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
Frt-hspB5
Plasmid#63096PurposeExpression of HSPB5 (small HSP) in mammalian cellsDepositorAvailable SinceApril 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pME-TAEL (JDW 1324)
Plasmid#224508PurposeGateway compatible middle entry clone containing TAEL2.0 transcription factor for making binary TAEL system vectors (generating a tissue specific driver)DepositorInsertTAEL
UseGateway CloningAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E 5X C120 c-fos min pro (JDW 1241)
Plasmid#224544PurposeA Gateway compatible 5' entry clone containing 5 TAEL transcription factor binding sites and a minimal c-Fos promoterDepositorInsert5x-C120-c-Fos promoter
UseGateway CloningAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE3_ mTFP1- Vamp2
Plasmid#201214PurposeAAV expression of TRE(TRE3G)-driven, Vamp2-conjugated mTFP1 expression for fluorescent labling of axon terminalsDepositorInsertmTFP1 (from addgene #54613)
UseAAVTagsmouse Vamp2ExpressionBacterial and MammalianPromoterTRE3GAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pME Lamin B Vhh mNeonGreen-pA (JDW 1312)
Plasmid#224501PurposeGateway compatible middle entry clone containing Lamin B nanobody fused to mNeonGreen with HA Tag (For visualizing the nuclear lamina, lamin chromobody)DepositorInsertLamin B Vhh mNeonGreen-pA
UseGateway CloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-On-Luciferase-P2A-H2A-mCherry (JDW 1154)
Plasmid#229840PurposeA Piggybac compatible, tet-on, dual reporter encoding luciferase followed by a P2A cleavage peptide and then an H2A fused mCherry for nuclear labeling.DepositorInsertLuciferase
ExpressionMammalianAvailable SinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-20nmEML-mRFP
Plasmid#231178PurposeStabilizes the ER-mitochondrial distance at 20 nm; tagged with mRFPDepositorInsert20nmEML-mRFP
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEN84 - CTCF-AID[71-114]-eGFP-FRT-Puro-FRT targeting construct
Plasmid#86230PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse CTCF locus using puromycine selection. Auxin-inducible degron system.DepositorInsertAID[71-114]-eGFP
UseMouse TargetingExpressionMammalianAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn FLEx-FRT Kir2.1-2A-GFP
Plasmid#161577PurposeExpression of Kir2.1-2A-GFP in a Flp-dependent fashionDepositorAvailable SinceNov. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-IRES-GFP/CREB3L1
Plasmid#214767PurposeMammalian expression of human CREB3L1DepositorAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Polymerase expression - pCMV-T7-EcKlenow (LM2692)
Plasmid#208963PurposeUnfused EcKlenow DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertEcKlenow-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-10nm-EBFP2
Plasmid#231184PurposeExpresses a synthetic linker, tagged with EBFP2, Stabilizing the ER-mitochondrial distance at 10 nmDepositorInsert10nm-EBFP2
ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
EGFP-P2A_BAF_G47E
Plasmid#101774PurposeExpresses mutant BAF (G47E) in human cells (with EGFP produced from the same transcript as expression control)DepositorInsertBAF (BANF1) (BANF1 Human)
UseLentiviralTagsEGFP-P2AExpressionMammalianMutationG47E mutationPromoterEF1aAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
mCherry-eDHFR-Cdc42Q61L
Plasmid#107267PurposemCherry-eDHFR-Cdc42Q61L in pIVT vector for in vitro transcription. Note that Cdc42 in this plasmid keeps its CAAX domain.DepositorAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only