We narrowed to 5,521 results for: crispr cas9 grna plasmid
-
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAUX_OL
Plasmid#166246Purposeuse as an auxiliary temperature-sensitive plasmid to successfully transform pdCas9_CL plasmidDepositorInsert[P112-sgRNA-term]-[J23116_B34-dCas9-B15]
ExpressionBacterialPromoterEc-TTL-P112 and BBa_J23116Available SinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMTKM07
Plasmid#233479PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and URA selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMTKM05
Plasmid#233477PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and Hyg selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMTKM01
Plasmid#233473PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and Nat selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMTKM03
Plasmid#233475PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and G418 selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCutamp
Plasmid#140632PurposePlasmid-curing in Escherichia coli by targeting the AmpR promoterDepositorInsertSpCas9_lambda-RED system, SacB, Rha induction system, sgRNA targeting AmpR promoter
UseCRISPRExpressionBacterialAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
MinLibCas9
Pooled Library#164896PurposeGenome-wide knockout library designed with two sgRNAs per gene.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceMay 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEHE51
Plasmid#250522PurposeVector for sgRNA expression in Acinetobacter baumannii (CRISPRi). Modified version of pYDE007 (Plasmid #194152) made Golden Gate compatible (BsaI) for sgRNA oligo insertion.DepositorInsertTwo BsaI sites (T-BsaI-BfuI-BsaI-A) inserted between the J23119 promoter and dCas9 handle/gRNA scaffold
ExpressionBacterialPromoterJ23119Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEditA
Plasmid#207531PurposePlasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ ABE:SpnCas9, PEM7→non-specific sgRNA; SmR/SpRDepositorInsertPlasmid for adenine base editing; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→ ABE:SpnCas9, PEM7→non-specific sgRNA
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-AAVS1
Plasmid#247356PurposeExpresses SpCas9 and a sgRNA targeting the human AAVS1 loci for knock-in.DepositorInsertAAVS1 (AAVS1 Human)
UseCRISPRAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNuc-cis
Plasmid#202796PurposeRK2-based conjugative plasmid containing the TevSpCas9 dual-endonuclease for targeted bacterial killingDepositorInsertTevSpCas9, sgRNA cassette, oriT, CenArsHis
ExpressionBacterialAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMTKM02
Plasmid#233474PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and split-Nat selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMTKM04
Plasmid#233476PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and split-G418 selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMTKM06
Plasmid#233478PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and split-Hyg selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMTKM08
Plasmid#233480PurposeSpCAS9-Tyr-[gRNA: BsaI GFP dropout] with pan(OPT)ARS replication origin and split-URA selection.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC89_CCR5(UbC-tEPOR-2A-YFP)
Plasmid#232404PurposeAAV production plasmid for UbC-tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at CCR5 locus using CCR5-sg3 gRNA. YFP is followed by a BGH polyA. AAV genome is flanked by AAV2 ITRs.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
MKC91_tEPOR(UbC-GFP-BGH)
Plasmid#232406PurposeAAV production plasmid for tEPOR-UbC-GFP-BGH vector from Fig. 1 that mediates HDR at EPOR locus using EPOR-sg1 gRNA. Repair vector introduces premature stop codon into EPOR locus.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
ABE7.10-F148A
Plasmid#132946PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertABE7.10(F148A)
UseCRISPR; Base editorExpressionMammalianMutationABE7.10(F148A)Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
BE3-hA3A-R128A
Plasmid#132944PurposeGene editing. See Gene/Insert section of the plasmid page for targeting sequence cloned into this plasmid.DepositorInsertBE3-hA3A(R128A)
UseCRISPR; Base editorExpressionMammalianMutationBE3-hA3A(R128A)Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
BE3-hA3A-Y130F
Plasmid#132945PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertBE3-hA3A(Y130F)
UseCRISPR; Base editorExpressionMammalianMutationBE3-hA3A(Y130F)Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
BE3-YE1
Plasmid#132943PurposeGene editing. See Gene/Insert section of plasmid page for targeting sequence cloned into this plasmid.DepositorInsertBE3-(W90Y-R126E)
UseCRISPR; Base editorExpressionMammalianMutationBE3-(W90Y-R126E)Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.13.EFS-NS.H2B-RFP
Plasmid#170388PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 13. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.4.EFS-NS.H2B-RFP
Plasmid#170365PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV.U6gT28.3.EFS-NS.H2B-RFP
Plasmid#170364PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Expressing nuclear RFP.DepositorInsertH2B-RFP
UseLentiviralPromoterEFS-NSAvailable SinceOct. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE_Tubb3 GFP(Y39TAG) KI
Plasmid#182678PurposeExpression of spCas9, gRNA targeting the end of Tubb3 gene and donor GFP(Y39TAG). Can be used for amber codon suppression and click chemistry labeling of endogenous beta-3 tubulin in mammalian cells.DepositorExpressionMammalianPromoterU6 and chicken beta-actin promoterAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only