We narrowed to 36,291 results for: lat
-
Plasmid#78125PurposeMammalian expression of miR34DepositorAvailable sinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available sinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLDPuro-hsnSR100N
Plasmid#35172DepositorPublicationAvailable sinceMarch 30, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSADdeltaG-BFP
Plasmid#32639DepositorPublicationInsertBFP
UseRabies virusExpressionMammalianPromoterCMVAvailable sinceDec. 16, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSIN REP5-GFP-GluR2 (Q)
Plasmid#24003DepositorAvailable sinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAcGFP-N1_CBP
Plasmid#221903PurposeTransient expression of GFP-tagged CBP in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCBP (CREBBP Human)
TagsGFPExpressionMammalianMutationN/AAvailable sinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-DHFRY100I-sfGFP-NLS-P2A-NLS-mCherry-P2A_ control UTRs
Plasmid#67929PurposeTranslational reporter - control UTRsDepositorInsertsfGFP-NLS-P2A-NLS-mCherry
UseLentiviralExpressionMammalianAvailable sinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PhiC31-Neo-ins-5xTetO-pEF-H2B-Citrine-ins
Plasmid#78099PurposeNuclear fluorescent reporter in mammalian cells, phiC31 attB for integration, can be silenced with TetR-CR or rTetR-CR (e.g. CR can be KRAB or DNMT3B).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHistone H2B - Citrine (H2BC21 Human, Synthetic)
UseSynthetic BiologyExpressionMammalianPromoter5xTetO pEF alphaAvailable sinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLVX-NLS-HA-TurboID
Plasmid#215075PurposeExpresses NLS-HA-TurboID in mammalian cells from a lentiviral vector.DepositorAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF0500
Plasmid#143709PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCDNA3 IRF7(5’UTR)-FF
Plasmid#85490PurposeFirefly luciferase under the control of IRF7 5'UTRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert5'UTR of IRF7 (Irf7 Mouse)
UseLuciferaseTagsLuciferaseExpressionMammalianAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK2-let-7 MT
Plasmid#78261PurposepsiCHECK2 dual luciferase reporter harboring a mutated let-7 target element, cloned into the XhoI/NotI restriction sites, the 3'UTR of the Renilla Luciferase geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmutated let-7 target site
UseLuciferase; Microrna activityExpressionMammalianMutationnucleotides 2-5 and 10-11 changed from CTCC to GA…Available sinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PER2:Luc Plasmid
Plasmid#206875PurposePer2 promoter luciferase reporterDepositorAvailable sinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-NFE2L2-Puro
Plasmid#181919PurposeLentiviral plasmid that directs the expression of NFE2L2/Nrf2 in mammalian cells.DepositorAvailable sinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG mito-mEos2
Plasmid#168515PurposeExpression of photoconvertible mEos2 targted to mitochondrial matrix to allow tracking of individual mitochondria and measurement of fission-fusion rateDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmito-mEos2
TagsmEos2ExpressionMammalianPromoterCAGAvailable sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMTL3
Plasmid#127966Purposeconstitutive expression of KRAB-dCas9-BFP-KRAB from the AAVS1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAAVS1-CAG-KRAB-dCas9-BFP-KRAB
UseTALENExpressionMammalianPromoterCAGAvailable sinceNov. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKD237-3a-2
Plasmid#90957PurposeExpresses ThsR and mCherry constitutively and sfGFP under the PphsA promoterDepositorInsertsThiosulfate response regulator
Superfolder GFP
mCherry
ExpressionBacterialPromoterBba_J23100, Bba_J23105, and PphsAAvailable sinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Ii-Str_SBP-mCherry-Ecadherin
Plasmid#65289Purposesynchronize trafficking of Ecadherin from the ER (RUSH system)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEcadherin
TagsIL-2 Signal Sequence and Streptavidin Binding Pro…ExpressionMammalianPromoterCMVAvailable sinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pMX Vav1 uGFP
Plasmid#14557DepositorAvailable sinceApril 12, 2007AvailabilityAcademic Institutions and Nonprofits onlyCited by