We narrowed to 4,072 results for: 28
-
Plasmid#192468PurposeBacterial expression of RvCAHS12DepositorInsertCAHS12
TagsHis6ExpressionBacterialPromoterT7Available SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
G-GECO1.2-Orai1Y80E
Plasmid#73565PurposeGreen fluorescent reporter of mutant Orai1Y80E-associated calcium influxDepositorInsertG-GECO1.2-Orai1Y80E (ORAI1 Human, Synthetic)
TagsG-GECO1.2ExpressionMammalianMutationchanged tyrosine 80 of Orai1 to glutamatePromoterCMV Immediate EarlyAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Linked Free NES
Plasmid#182485PurposeYeast integrative plasmid for expressing fusion protein ERG20-AcNES1, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertFPPS-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked Free PcPTS
Plasmid#182486PurposeYeast integrative plasmid for expressing fusion protein ERG20-PcPTS, with linker sequence AG4TGGA (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3)DepositorInsertFPPS-PTS
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
Coexpressed Free GFP-NES
Plasmid#182491PurposeYeast integrative plasmid for expressing ERG20 (GAL10 promoter) and fusion protein GFP-AcNES1 (GAL7 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsFPPS
GFP-NES
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL10 and GAL7Available SinceNov. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-CLCb (EED/QQN)
Plasmid#47422DepositorInsertCLCb EED/QQN (CLTB Human)
TagsEGFPExpressionMammalianMutationEED changed to QQN, in aa20-41 regionPromoterCMVAvailable SinceJuly 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-IRG1-H159Q-HA
Plasmid#198183PurposeMammalian expression of HA-tagged human ACOD1 (IRG1) H159QDepositorInsertACOD1 (ACOD1 Human)
TagsHAExpressionMammalianMutationThe histidine in IRG1 at position 159 mutates to …PromoterCMVAvailable SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[TreR-T,LacI-T]
Plasmid#60770PurposeContains PI driving expression TreR-T, and PI driving expression of LacI-T.DepositorInsertsTreR-T
Dimeric LacI with the TAN DBD
UseSynthetic BiologyExpressionBacterialMutationDimeric LacI with the TAN DBD. and LacI/GalR repr…Available SinceJuly 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA8-Flag-LARS(721-1176aa)
Plasmid#139690PurposeExpresses N-teminal Flag tagged aa 721-1176 of LARS1DepositorAvailable SinceJuly 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
[pSK483] pLJC5 Flag-Depdc5(P)
Plasmid#109342PurposeLenti-viral expression of Flag-tagged Depdc5 mutant PDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pet21a-aGFPnb-enhancer-cys-linker-YbbR-(PAS)5-H6
Plasmid#192788PurposeaGFP nanobody enhancer tagged with cysteine, YbbR and H6 for bacterial expression, purification and labelingDepositorInsertantiGFP nanobody enhancer
TagsH6 and ybbRExpressionBacterialAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p3E-DrCav1
Plasmid#194290PurposeMultisite gateway entry clone for expression of codon optimised zebrafish caveolin1 with fusion tag at the N-terminus. Parton lab clone KRTDepositorInsertcaveolin1 (cav1.S Frog)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[TreR-T]
Plasmid#60754PurposeContains PI driving expression TreR-T, the Trehalose inducible chimera with the TAN DBD.DepositorInsertsTreR-T
GalS-T
UseSynthetic BiologyExpressionBacterialMutationChimeric LacI/GalR repressor with the TAN DBD and…Available SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
[pSK476] pLJC5 HA-Depdc5(B)
Plasmid#109345PurposeLenti-viral expression of HA-tagged Depdc5 mutant BDepositorAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
[pSK496] pLJC5 HA-Depdc5(AB)
Plasmid#109346PurposeLenti-viral expression of HA-tagged Depdc5 mutant ABDepositorInsertDepdc5 (DEPDC5 Human)
UseLentiviralTagsHAMutationDIYGD(185-189)GSGSG;EQPLH(371-375)GSGSGAvailable SinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only