We narrowed to 5,415 results for: mos
-
Plasmid#219716PurposeDV2 stable E dimer with fusion loop mutationDepositorInsertDV2 sE SC10
Tags8xHis and human serum albumin (HSA)ExpressionMammalianMutationG106D, A259W, T262R, F279W, T280PAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
Frt-hspB8
Plasmid#63099PurposeExpression of HSPB8 (small HSP) in mammalian cellsDepositorAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Recruited polymerase expression - pCMV-T7-EcKlenow-CC(N5) (LM2696)
Plasmid#208969PurposeRecruited EcKlenow DNA polymerase (-exo) with a C-terminal N5 coiled coil (CC) domain, expressed from CMV or T7 promoters.DepositorInsertEcKlenow-BPNLS-CC(N5)
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationEcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
p4949 pLPCX-His-Xpress NLS hBrd4 CTD
Plasmid#14459DepositorInsertBrd4 CTD (BRD4 Human)
UseRetroviralTagsSV40 NLSExpressionMammalianMutationamino acids 1047-1362 of Brd4 (the CTD). Function…Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-ccdB-mRuby3
Plasmid#166139PurposeGateway destination vector for generation of Galactose-inductibe, C-terminal mRuby3-tagged proteins in yeast. Contains a CEN/ARS element for low copy number when in yeast.DepositorTypeEmpty backboneTagsmRuby3ExpressionYeastAvailable SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Tet-on-vsv-CenpB 1-166-dCEN- Incenp-GFP
Plasmid#108484Purposeinducible expression of vsv-CenpB-1-166-dCEN-INCENP-EGFPDepositorInsertCenpB-dCEN-INCENP (INCENP Human)
TagsEGFP and VSVExpressionMammalianMutationCEN box replaced by CenpB 1-166PromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.1.mKO2
Plasmid#85209PurposeTRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV4Neo-murine IL-17RASEFIR-HA
Plasmid#46863Purposeexpresses mouse IL-17RA with SEFIR deletionDepositorInsertIL-17RA-delta-SEFIR (Il17ra Mouse)
Tags3x HAExpressionMammalianMutationDeletion of SEFIR domain (AA 394-485)PromoterCMVAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMK-AttL1-NotI/BamHI-U6-BsaI-tracrRNAopt-BamHI-U6-SapI-tracrRNAopt-NotI/XbaI-7sk-BsmBI-tracrRNA-XbaI-AttL2
Plasmid#190898PurposeEntry vector for multiple sgRNA cloningDepositorTypeEmpty backboneUseCRISPRExpressionBacterial and MammalianPromoterU6 and 7skAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-F1.GS.CAR-2G
Plasmid#194461PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.F1 in VH-VL order and (GGGGS)3 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLPC-Myc-TRFcT
Plasmid#44573DepositorUseRetroviralTagsMycExpressionMammalianMutationTRF2 where TRFH domain (aa42-241) has been replac…Available SinceMay 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-B5.GS.CAR-2G
Plasmid#194463PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.B5 in VH-VL order and (GGGGS)3 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Frt-hspB2
Plasmid#63093PurposeExpression of HSPB2 (small HSP) in mammalian cellsDepositorAvailable SinceMarch 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
HOXA9 (murine) FLAG pRC/CMV
Plasmid#8514DepositorInsertHOXA9 (Hoxa9 Mouse)
TagsFLAG and HisExpressionMammalianMutationFLAG epitope tag replaces T7 tag in the pET back…Available SinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
GFP-AuroraB L154G/H250Y
Plasmid#108492Purposeexpression of EGFP-AuroraB Analog sensitive (L154G/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsEGFPExpressionMammalianMutationAnalog sensitive L154G/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCR3-Flag-AuroraB KD (K106R)
Plasmid#108488Purposeexpression of Flag-AuroraB kinase death (K106R)DepositorInsertAuroraB (AURKB Human)
TagsFlagExpressionMammalianMutationKinase death K106APromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRRL.SIN.EF1A.JAG1-F1.218.CAR-2G
Plasmid#194459PurposeCAR featuring: GMCSF (sig. peptide); CD8A & CD8A (hinge & TM); 4-1BB & CD3ζ (signaling domains); anti-JAG1 from J1.F1 in VL-VH order and 218 linker (scFv). GFP-Zeo for selection and monitoring.DepositorInsertAnti-JAG1 CAR
UseLentiviralAvailable SinceMarch 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a del.SHD
Plasmid#40036DepositorInserthSlp4-a del.SHD (SYTL4 Human)
TagsEGFPExpressionMammalianMutationdeleted SHD domain (1-143)PromoterCMV promoterAvailable SinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTol2-PcyA-IRES-HO1
Plasmid#131787PurposeTol2 bicistronic vector expressing PcyA and HO1 for Phycocyanobilin (PCB) synthesis, driven by heatshock promoter hsp70.DepositorInsertPcyA and HO1
UseSynthetic Biology; Zebrafish tol2 transposonTagsMTS (Mitochondrial Targeting Signal from subunit …ExpressionMammalianPromoterhsp70Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only