We narrowed to 9,148 results for: sgRNA
-
Plasmid#211980PurposeExpress gRNA against POU5F1 with puro and BFPDepositorInsertsgRNA targeting POU5F1 (POU5F1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(POU5F1_g15-14)-PGKpuroBFP-W
Plasmid#211981PurposeExpress gRNA against POU5F1 with puro and BFPDepositorInsertsgRNA targeting POU5F1 (POU5F1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
GuideVector_BbsI
Plasmid#110692PurposeFor rapid cloning and expression of sgRNAs in mammalian cells. Contains copGFP for easy FACS sorting.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g1 (BB22)
Plasmid#139457PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g1 (BB34)
Plasmid#139452PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Puro-NCOA7g2 (BB23)
Plasmid#139458PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes puromycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: puroR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Usp5
Plasmid#174873PurposeCRISPR vector for generating Usp5 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Usp5 (Usp5 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Wnk1
Plasmid#174874PurposeCRISPR vector for generating Wnk1 STREAMING-tag KI cellDepositorInsertsgRNA for mouse Wnk1 (Wnk1 Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJK434
Plasmid#155378PurposePphlF_A4NT, 1x cascade + [dCas9 + PA4-mVenus]. (Integration of 429; pOSIP)DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A4NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)Available SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJK430
Plasmid#155377PurposePphlF_A2NT in dCRv1, 2x cascade + [dCas9 + PA4-mVenus]DepositorInsertsdCas9 (bacteria)
PA4-mVenus
PphlF_A2NT in dCas9 sgRNA oscillator v1
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)AvailabilityAcademic Institutions and Nonprofits only -
pX330-TAF1-A
Plasmid#247346PurposeExpresses SpCas9 and a sgRNA targeting the human TAF1-A loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pW213-lenti-sasgRNA-Esp3I-2kb-filler-pEF1s-NLS-mNeonGreen-P2A-BlastR
Plasmid#170811PurposeLentiviral vector to co-express an sasgRNA with NLS-mNeonGreenDepositorTypeEmpty backboneUseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
L40C-CRISPR.EFS.mNeon
Plasmid#69146PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA (hU6), mNeon coexpression, EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pW188-lenti-spsgRNA-lacZ-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170813PurposeLentiviral vector to co-express a lacZ control spsgRNA with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
Cas12f-GE ver4.0
Plasmid#176543PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver4.0
Cas12f-GE ver4.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro PRMT5-CRISPRi
Plasmid#164637PurposelentiGuide-Puro backbone with cloned target sequence for human PRMT5. The insert is: 5´- CACCGAGCCGCGTGTCCAGCGGGA-3. sgRNA achieves a downregulation of PRMT5 in combination with dCAS9-KRAB-MCP2DepositorInserttarget guide sequence PRMT5 inhibition (PRMT5 Human)
UseCRISPR and Lentiviral; InterferenceExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7gRNA-ttn.1_C3
Plasmid#140866PurposesgRNA synthesis vector for ttn.1_C3 (zebrafish titin .1).DepositorInsertzebrafish ttn.1_C3 sgRNA for in vitro transcription (ttn.1 Synthetic, Zebrafish)
UseIn vitro transcription of sgrnasAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_2_SpGCas9
Plasmid#233457PurposeLevel 2 RECKLEEN plasmid, genome editing of Klebsiella pneumoniaeDepositorInsertLevel 2 RECKLEEN plasmid
UseCRISPRAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only