We narrowed to 31,022 results for: des.2
-
Plasmid#83087PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pCDNA4TO R99A CoV-2 nsp1 3xFLAG
Plasmid#176061PurposeExpresses R99A CoV2 nsp1 in mammalian cells. This contains a C-terminal 3xFLAG fusion to nsp1.DepositorAvailable SinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7a-2-3p
Plasmid#103144PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7a-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7a-2-3p target (MIRLET7A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Anti-SCG10/Stathmin-2 [L5/1R]
Plasmid#140065PurposeMammalian Expression Plasmid of anti-SCG10/Stathmin-2 (Rat). Derived from hybridoma L5/1.DepositorInsertanti-SCG10/Stathmin-2 (Rat) recombinant mouse monoclonal antibody (Stmn2 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceJune 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-26a-2-3p
Plasmid#103378PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-26a-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-26a-2-3p target (MIR26A2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7f-2-3p
Plasmid#103155PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7f-2-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7f-2-3p target (MIRLET7F2 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-SARS-CoV-2-S-ectodomain
Plasmid#235984PurposeInternally tagged SARS-CoV-2 spike ecto-domainDepositorInsertSpike protein (S SARS-CoV-2)
Tags8xHis and Twin-Strep tag and internal Twin-Strep …ExpressionMammalianMutationaa 1-1208, D614G, RRAR684-684GSAS, and DK987-987P…PromoterCMVAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(AAVS1-2)-PGKpuroBFP-W
Plasmid#211955PurposeExpress safe-cutter control gRNA with puro and BFPDepositorInsertsafe-cutter control sgRNA_AAVS1-2 (AAVS1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterHuman U6 promoterAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 NKX6-2-Venus S246A/T252A
Plasmid#209180PurposeMammalian expression of human NKX6-2 T252D phosphoresistant mutantDepositorInsertNKX6-2 (S246A/T252A) fused with Venus (NKX6-2 Human)
TagsVenusExpressionMammalianMutationNKX6-2 (S246A/T252D)PromoterCMVAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only