We narrowed to 13,998 results for: EGFP
-
Plasmid#196701PurposePlasmid for stable expression of wild type bacterial RNase HI tagged with NES and EGFP that can be used to specifically degrade the DNA-RNA hybrids in the cytoplasm.DepositorInsertbacterial RNaseHI
UseLentiviralAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
LncRNA overexpression EF1α_BbsI_SV40 polyA_EGFP
Plasmid#219828PurposeOverexpression vector for non-coding RNAs driven by EF1α promoter with GFP. Cloning using BbsI.DepositorTypeEmpty backboneExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB-TetON-mEGFP-MYOD1_AroPERFECT
Plasmid#215620PurposeFor integration of MYOD1 AroPERFECT T2A mEGFPDepositorAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-eGFP-2A-mCherry_D4H
Plasmid#194875PurposeRatiometric D4H sensor for in vivo neuron-specific cholesterol visualizationDepositorInsertGFP-T2A-mCherry-D4H
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-ORP8-H514A-H515A
Plasmid#208360PurposeMammalian expression of fluorescent N-terminally tagged H514A-H515A mutant of ORP8DepositorAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCI-neo FlucDM EGFP
Plasmid#90172PurposeEGFP-tagged constructs to monitor the aggregation state of the sensors and the ability of cells to solubilize or degrade the aggregated proteins. FLuc contains double mutationDepositorInsertFLuc EGFP
ExpressionMammalianMutationR188Q, R261Q in FLucAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synapsin-WHaloCaMP1a-EGFP
Plasmid#205307PurposeProduction of AAV particles encoding WHaloCaMP1a-EGFP from the synapsin promoterDepositorInsertWHaloCaMP1a-EGFP
UseAAVAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-human lyn–GFP
Plasmid#35958PurposeExpresses human lyn protein codon optimized for zebrafish expression.DepositorAvailable SinceApril 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-Myr_mCherry-2A-eGFP
Plasmid#194877PurposeRatiometric Myr/Palm_mCherry control probeDepositorInsertMyristoylated/Palmitoylated_mCherry-T2A-GFP
UseAAVExpressionMammalianPromoterhuman SynapsinAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
IRE1 alpha-pcDNA3.EGFP
Plasmid#13009DepositorInsertInositol Requiring Enzyme-1 (ERN1 Human)
ExpressionMammalianAvailable SinceNov. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
TetOn-CLIMP63-mCherry-eGFP
Plasmid#139871PurposeDox-inducible lentiviral expression of human CLIMP63DepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a SnoopTag-mEGFP-SpyTag
Plasmid#72325PurposeBacterial expression of monomeric enhanced green fluorescent protein (mEGFP) containing SnoopTag at the N-terminus and SpyTag at the C-terminus, for programmed polyprotein synthesis.DepositorInsertpET28a SnoopTag-mEGFP-SpyTag
TagsN-terminal His6 tagExpressionBacterialAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
VE-cad-eGFP Donor plasmid
Plasmid#92309PurposeKnock eGFP into human VE-cad locusDepositorInsertVEcad Homologous Recombination Arms (CDH5 Human)
UseCRISPRExpressionMammalianMutationabout 30 a.a. truncated at end of proteinAvailable SinceAug. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 human cofilin S3E
Plasmid#50861Purposeexpresses psuedo-phosporylated, non-activatable cofilin fused to EGFP in mammalian cellsDepositorInsertcofilin 1 S3E (CFL1 Human)
TagsEGFPExpressionMammalianMutationS3E psuedo-phosporylated, non-activatablePromoterCMVAvailable SinceFeb. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EGFP-Rac1-T17N
Plasmid#12982DepositorAvailable SinceOct. 27, 2006AvailabilityAcademic Institutions and Nonprofits only -
pDest eGFP MBNL1 42 kDa
Plasmid#61277PurposeMammalian expression of EGFP-tagged human MBNL1DepositorAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pInducer10b-EGFP-KRAS G12V
Plasmid#164925PurposeExpresses EGFP cDNA and KRAS G12V cDNA in mammalian cellsDepositorInsertsUseLentiviralMutationGlycine 12 changed to valine (G->T 3156)PromoterUbc Promoter and Ubc promoterAvailable SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Tox2-IRES-eGFP
Plasmid#165428PurposeExpresses TOX2 in mammalian cellsDepositorAvailable SinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
TetOn-REEP5-mCherry-eGFP
Plasmid#139870PurposeDox-inducible lentiviral expression of human REEP5DepositorAvailable SinceMarch 24, 2020AvailabilityAcademic Institutions and Nonprofits only