We narrowed to 5,372 results for: Mos
-
Plasmid#135495PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (Y84P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationY84PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-HLA-A2-VN (E166P)
Plasmid#135498PurposeMammalian expression of VN-fused and myc-tagged HLA-A*02:01 (E166P mutant)DepositorInsertHLA-A*02:01 (HLA-A Human)
TagsExtracellular c-myc epitope tag, Signal peptide f…ExpressionMammalianMutationE166PPromoterCMVAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-AuroraB L154A/H250Y
Plasmid#108491Purposeexpression of EGFP-AuroraB Analog sensitive (L154A/H250Y)DepositorInsertAuroraB (AURKB Human)
TagsEGFPExpressionMammalianMutationAnalog sensitive L154A/H250YPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCR3-vsv-INCENP d543-746
Plasmid#108473Purposeexpression of vsv-INCENP d543-746DepositorInsertINCENP d543-746 AA (INCENP Human)
TagsVSVExpressionMammalianMutationDelta Alpha helix, aa543-746 deletedPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a I18A
Plasmid#40043DepositorInserthSlp4-a I18A (SYTL4 Human)
TagsEGFPExpressionMammalianMutationIsoleucine 18 to AlaninePromoterCMV promoterAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 hSlp4-a linker
Plasmid#40040DepositorInserthSlp4-a linker (SYTL4 Human)
TagsEGFPExpressionMammalianMutationlinker domain (144-353)PromotercmvAvailable SinceOct. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
5` CC: Puro – loxP – GFP-C
Plasmid#219563Purpose5` circularization cassette.Used in combination with one of the 3' circularization cassettes to induce Cre-mediated circularizazion or inversion of a desired genomic region.DepositorInserthPGK-promoter_PuroR_2A_loxP_GFP-C
UseUnspecifiedPromoterhPGKAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
CIRTS-control
Plasmid#213788PurposeCIRTS RNA targeting system for targeted knockdown in neurons. CIRTS-Calm3 and scramble control guide RNA is expressed under human Syn1 and U6 promoter, respectively.DepositorInsertCIRTS-Calm3-U6-control gRNA
UseLentiviralTagsGFPExpressionMammalianPromoterSyn1, U6Available SinceFeb. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E-EFS (EF1a core) (JDW 1319)
Plasmid#224474PurposeGateway compatible 5' entry clone with human alpha 2 globin pause site (to prevent transcription readthrough) and EF1a core promoter. Lacks downstream intron for a lower-activity, compact promoter.DepositorInsertEFS promoter
ExpressionMammalianAvailable SinceSept. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
RUNX1_pcDNA6.2/EmGFP-Bsd
Plasmid#176974PurposeMammalian expression vector encoding RUNX1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-BUBR1
Plasmid#234704Purposeexpression of fusion proteinDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
9_T7-mScarlet3-LactC2
Plasmid#225936PurposeIn vitro synthesis of mRNA for fluorescent protein mScarlet3 tagged with the LactC2 membrane localisation signalDepositorInsertmScarlet3-LactC2
UseIn vitro transcriptionPromoterT7Available SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway-compatible destination vector with cre-dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cre-IRES-PuroR
Plasmid#30205PurposeLentiviral coexpression of Cre and puromycin from the human EF1a promoterDepositorInsertCre recombinase (cre Enterobacteria phage P1)
UseCre/Lox and LentiviralExpressionMammalianPromoterEF1alphaAvailable SinceApril 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
GLI1_pcDNA6.2/EmGFP-Bsd
Plasmid#176968PurposeMammalian expression vector encoding GLI1 and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-N1 GBP (GBP-mCherry)
Plasmid#162879PurposeExpression in mammalian cells of GFP binding protein (GBP) tagged with mCherryDepositorInsertGFP Binding Protein
TagsmCherryExpressionMammalianAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1_HyPer7_mito
Plasmid#238968PurposeMammalian neurons HyPer7 expression targeted to the mitochondrial matrixDepositorInsertHyPer7
UseAAVTags3x Cytochrome C Oxidase Subunit VIII presequenseExpressionMammalianPromoterhSyn1Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME Actin Vhh Halo Tag (JDW 1223)
Plasmid#224498PurposeGateway compatible middle entry clone containing an Actin nanonbody fused to a flexible linker and Halo Tag (For visualizing actin, actin chromobody)DepositorInsertActin-Vhh-Halo-Tag
UseGateway cloningAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-E-'No'Mi-Red-T2A-Puro
Plasmid#246642PurposeEF-1alpha driven EV reporter E-'No'Mi-R, a re-engineered tetraspanin scaffold tagged with bioluminescent and fluorescent reporter proteins. Nanoluc and Flag tag are removable with TEVp.DepositorInsertcleavable E-NoMi-Red
UseLentiviralTagsFLAG-Nanoluciferase and mCherryExpressionMammalianPromoterEF-1alphaAvailable SinceOct. 16, 2025AvailabilityAcademic Institutions and Nonprofits only