We narrowed to 10,269 results for: tre promoter
-
Plasmid#146491PurposeInsect Expression of DmPABPC1-RRM2-RRM3DepositorInsertDmPABPC1-RRM2-RRM3 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-RRM3-RRM4-V5His6_H
Plasmid#146492PurposeInsect Expression of DmPABPC1-RRM3-RRM4DepositorInsertDmPABPC1-RRM3-RRM4 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmGW182-V5His6_H
Plasmid#146499PurposeInsect Expression of DmGW182DepositorInsertDmGW182 (gw Fly)
ExpressionInsectMutationTwo non silent mutations V704A and N799S and one …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-DmPABPC1-RRM1-RRM2-V5His6_H
Plasmid#146479PurposeInsect Expression of DmPABPC1-RRM1-RRM2DepositorInsertDmPABPC1-RRM1-RRM2 (pAbp Fly)
ExpressionInsectAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1_1-550-siRNAres_L
Plasmid#146859PurposeInsect Expression of DmPABPC1_1-550-siRNAresDepositorInsertDmPABPC1_1-550-siRNAres (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and six silent muta…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1_90-635-siRNAres-V5His6_L
Plasmid#146860PurposeInsect Expression of DmPABPC1_90-635-siRNAresDepositorInsertDmPABPC1_90-635-siRNAres (pAbp Fly)
ExpressionInsectMutationfive silent mutations compared to the sequence gi…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-DmPABPC1-del91-164-V5His6_L
Plasmid#146861PurposeInsect Expression of DmPABPC1_del91-164DepositorInsertDmPABPC1_del91-164 (pAbp Fly)
ExpressionInsectMutationone non silent mutation G26S, and five silent mut…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX-2T-TRR-C421-G2304D
Plasmid#182845Purposemutation G2304D (GGC/GAC), PCR product coding C-terminal residues 2011-2431 of TRR was inserted into modified pGEX-2T by Nde I-Nsi I sitesDepositorAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
human TLNRD1-4H pET151
Plasmid#159386PurposeExpresses human TLNRD1 4-helix domain (residues 143-273) in bacterial cellsDepositorInsertTalin Rod Domain Containing Protein 1 (TLNRD1 Human)
Tagshis-tag, TEV cleavage siteExpressionBacterialMutationTLNRD1 4-helix domain (residues 143-273)PromoterT7Available SinceJuly 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4-Tet-on-vsv-Incenp d543-746iPRC1_279-482-GFP
Plasmid#108500Purposeinducible expression of vsv-INCENP d543-746iPRC1 279-482-EGFPDepositorInsertINCENP d543-746iPRC1 304-509 (PRC1 Human)
TagsEGFP and VSVExpressionMammalianMutationdelta alpha Helix, insert PRC1 microtubule domainPromoterCMVAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pIR-CMV-SCN2A-Variant-1-IRES-mScarlet
Plasmid#162279PurposeEukaryotic expression of human SCN2A variant 1 isoform. This channel has been modified to be stably maintained in standard bacterial strains.DepositorInsertSCN2A Variant 1, stabilized (SCN2A Human)
TagsIRES-mScarletExpressionMammalianMutationIVS intron inserted after bp4551.PromoterCMVAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4TO-SCN8A-Variant-1-IRES-mScarlet
Plasmid#162280PurposeEukaryotic expression of human SCN8A variant 1 isoform. This channel has been modified to be stably maintained in standard bacterial strains.DepositorInsertSCN8A Variant 1, stabilized (SCN8A Human)
TagsIRES-mScarletExpressionMammalianMutationModified human HSPA5 intron 4 inserted after bp23…PromoterCMVAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pATP416-ptetO7-pphlO6-crtYBI
Plasmid#165976PurposeExpresses carotenoid biosynthesis gene in response to 2,4-diacetylphloroglucinol and doxycycline in yeast expressing rtTA and PhlTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pphlO6), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-ORP8-H514A-H515A
Plasmid#208360PurposeMammalian expression of fluorescent N-terminally tagged H514A-H515A mutant of ORP8DepositorAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-pphlO6-crtYBI
Plasmid#165977PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and 2,4-diacetylphloroglucinol in yeast expressing PhlTA and LuxTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-shR
Plasmid#208358PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22bDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations introduced to render shRNA …PromoterCMVAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT-ubb-Avi-Cerulean-RanGAP
Plasmid#79881PurposeUbiquitin promoter driving Avi-tagged protein containing Cerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1); flanked by Tol2 sequencesDepositorInsertCerulean protein fused to the carboxy-terminal domain of avian Ran GTPase-activating protein 1 (RanGap1) (RANGAP1 Chicken)
TagsAviExpressionBacterialPromoterUbiquitin promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pATP416-pluxO5-ptetO7-crtYBI
Plasmid#165975PurposeExpresses carotenoid biosynthesis gene in response to homoserine lactone and doxycycline in yeast expressing LuxTA and rtTADepositorInsertsXanthophyllomyces dendrorhous phytoene-beta carotene synthase (crtYB) mRNA, complete cds
Xanthophyllomyces dendrorhous phytoene desaturase mRNA, complete cds
BTS1 (BTS1 Budding Yeast)
UseSynthetic BiologyExpressionYeastMutationC1281A, G1698A and C66A, C1359TPromoterSynthetic promoter (pluxO5), Synthetic promoter (…Available SinceMarch 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.BRWD3-V5H
Plasmid#48624PurposeExpresses Drosophila BRWD3 (with V5 and His tags at the C-terminus) in mammalian cellsDepositorInsertBRWD3 (BRWD3 Fly)
TagsV5 and His tagsExpressionMammalianMutationno mutations, stop was removed to fuse V5His at C…PromoterCMVAvailable SinceOct. 15, 2013AvailabilityAcademic Institutions and Nonprofits only