We narrowed to 10,733 results for: tre promoter
-
Plasmid#236454Purposetransient overexpression of IP3R3 in mammalian cellsDepositorAvailable SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pLKO-Tet-On shYAP1-6
Plasmid#193667PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-2
Plasmid#193665PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1 Full length Importin beta
Plasmid#106941PurposeTransient expression of GFP-tagged Importin beta in mammalian cells (CMV promoter)DepositorInserthuman Importin beta-1 (KPNB1) (KPNB1 Human)
TagsGFPExpressionMammalianPromoterCMV promoterAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAdCMV/V5-DEST-Y705F-STAT3-3xFlag
Plasmid#99261PurposeAdenoviral vector encoding Flag-tagged murine STAT3 (Y705F)DepositorInsertSignal transducer and activator of transcription 3 - Y705F (Stat3 Mouse)
UseAdenoviralTags3x-FlagMutationY705F (contains a silent mutation: nucleotide 271…PromoterCMVAvailable SinceJan. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR2
Plasmid#167001PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR3
Plasmid#167002PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR10
Plasmid#167003PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD7
Plasmid#65379PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD9
Plasmid#65380PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
plenti-CAG-IKZF1-V1-FLAG-IRES-GFP
Plasmid#107387PurposeLentiviral expression of IKZF1-V1-FLAGDepositorAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ1B
Plasmid#65372PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceJune 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLX307 HRAS
Plasmid#117748PurposeOpen reading frame vector encoding HRASDepositorInsertRASH1 (HRAS Human)
UseLentiviralTagsV5ExpressionMammalianMutationClosed vector so will not read through the V5 reg…PromoterEF1aAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL WT (siRNA resistant)
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ2A
Plasmid#65373PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
Myc-KLC1
Plasmid#166964PurposeExpresses Myc-tagged KLC1 protein in pcDNA3.1DepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSCV-HA-Nr4a1
Plasmid#160941PurposeGeneration of retrovirus for the overexpression of Nr4a1DepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRD1
Plasmid#65375PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-BRPF1
Plasmid#65382PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only