We narrowed to 24,195 results for: OMP;
-
Plasmid#129604PurposeIn vivo visualization of focal adhesions (can be used for colocalization studies)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPaxillin
ExpressionMammalianPromoterCMVAvailable sinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GFP-NPM NLS1/2D
Plasmid#13287DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNPM (NPM1 Human)
TagsFlagExpressionMammalianMutationDeletion of aa134-aa142, aa150-aa155Available sinceOct. 16, 2006AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENTR_L1-Turbo-NES-YFP-STOP-L2
Plasmid#127358Purposegateway entry vector for expressing cytosolic TurboID-YFP under a promoter of choiceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTurboID (BirA mutant)
UseGateway CloningTagsGS linker, NES, V5, and YFPMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…Promoterno promoterAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO V5 DNAJA2
Plasmid#19519DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDnaJ (Hsp40) homolog, subfamily A, member 2 (DNAJA2 Human)
TagsV5ExpressionMammalianAvailable sinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mCRISPRi-v2, Kinases, Phosphatases, and Drug Targets (m1), top 5 sgRNAs/gene
Pooled library#83989PurposeMouse CRISPRi Pooled Library tartgeting kinsases, phosphatases and Drug TargetsDepositorAvailable sinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFB2E
Plasmid#195288PurposeBicistronic HSV-TK-EGFP fusion and Puromycin resistance for positive/negative selectionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertHSV-TK EGFP 2A Puro
ExpressionMammalianPromoterEFSAvailable sinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3 RARE-d2EGFP
Plasmid#183055PurposeDestabilized EGFP fluorescent reporter for Retinoic Acid activityDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertd2EGFP
PromoterRARE, SV40Available sinceApril 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
ITPKA-mNeonGreen
Plasmid#98883PurposeIn vivo visualization of actin cytoskeleton (can be used for colocalization studies)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertITPKA
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBiex-1 Myosin VI HMM_eGFP
Plasmid#82714PurposeExpresses Myosin VI HMM with a C-terminal eGFP.DepositorInsertMyosin VI
TagsFLAG purification tag and eGFPExpressionBacterial and InsectPromoterT7 PromoterAvailable sinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSKDuet16
Plasmid#41684DepositorPublicationInsertNpuDnaE intein
TagsGB1 and His-tagExpressionBacterialPromoterT7Available sinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAT-YFP-TetR
Plasmid#59018PurposeExpresses a fusion of yellow fluorescent protein (YFP) to the N-terminus of the Escherichia coli Tn10 tet repressor (TetR) driven by the alpha tubulin promoter for use in T. gondiiDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertYFP-TetR
UseToxoplasma expressionPromoteralpha-tubulinAvailable sinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFastBac-hDicer
Plasmid#89144PurposeExpression of hDicer in Sf9 CellsDepositorAvailable sinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
M-tdTom-SP
Plasmid#48677PurposeMammalian tdTomato activation reporter for SP with GTCCCCTCCACCCCACAGTG protospacerDepositorInsertTAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9
UseCRISPRPromoterSp6Available sinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGGAselect
Plasmid#195714PurposepGGAselect is a cloning vector for Golden Gate Assembly using BsaI, BsmBI, and BbsI Type IIS restriction enzymes.DepositorTypeEmpty backboneUseSynthetic BiologyAvailable sinceFeb. 24, 2023AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pBADZ-HisCre
Plasmid#111187PurposeHelper plasmid containing Cre-recombinase gene, which is expressed in DH10MultiBac cellsDepositorInsertCre recombinase
TagsHis tagExpressionBacterialAvailable sinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-COXIV-COX8-dL5-2XG4S-mCer3
Plasmid#73208PurposeExpresses dL5(E52D)-mCer3 fusion protein in mitochondria of mammalian cells. (MBIC5, dL5**, FAP)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCOXIV-COX8-dL5-2XG4S-mCer3 (COX8A Human, Synthetic)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable sinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3
Plasmid#73205PurposeExpresses myc-dL5(E52D)-mCer3 fusion protein in nuclei of mammalian cells. (MBIC5, dL5**, FAP)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNLS-myc-dL5-2XG4S-mCer3 (MYC Human, Synthetic)
TagsThe FAP and mCerulean3 are fused with 2 copies of…ExpressionMammalianMutationThe dL5** FAP is E50D, L89S, also known as E52D/L…PromoterCMVAvailable sinceMarch 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-RIα-EGFP
Plasmid#181840PurposeGFP-tagged PKA RIα subunit for mammalian expression.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRIα-EGFP (PRKAR1A Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pENTR_L1-miniTurbo-YFP-NLS-STOP-L2
Plasmid#127362Purposegateway entry vector for expressing nuclear miniTurbo-YFP under a promoter of choiceDepositorInsertminiTurbo (BirA mutant)
UseGateway CloningTagsGS linker, NLS, V5, and YFPMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Promoterno promoterAvailable sinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-T/O-Ds1-mCherry
Plasmid#112855PurposeDox inducible expression in mammalian cells of Ds1 protein fused to mCherry fluorescent proteinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDCHS1 (DCHS1 Human)
TagsmCherryExpressionMammalianPromoterdoxycycline inducible promoterAvailable sinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by