We narrowed to 5,008 results for: AAT
-
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
RPS15A sgRNA-5 lentiCRISPR v2-Blast plasmid
Plasmid#192230Purposelentiviral vector expressing sgRNA-5 targeting eIF3 binding site of RPS15A 5'UTRDepositorInsertsgRNA-5 targeting eIF3 binding site of RPS15A 5'UTR (RPS15A Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shTgm5-1
Plasmid#180394PurposeProducing AAV that encodes mouse Tgm5 shRNA-1 with miR-E backboneDepositorAvailable SinceNov. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_BLK_P4
Plasmid#124458PurposeFor CRISPR-mediated epigenome editing of human BLK gene locusDepositorInsertBLK_P4_gRNA (BLK Human)
ExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
piwi_sgRNA
Plasmid#186653Purposepiwi sgRNA plasmidDepositorInsertPiwi sgRNA Plasmid (piwi Fly)
ExpressionInsectAvailable SinceAug. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459-Mcm2-2A mutation sgRNA
Plasmid#186936PurposesgRNA used for genetic mutation at Y81 and Y90 of Mcm2DepositorInsertMcm2-2A mutation sgRNA (Mcm2 Mouse)
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6Available SinceAug. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
Nbr_C_sgRNA2
Plasmid#186664PurposeNbr C-tag sgRNA2 plasmidDepositorInsertNbr sgRNA 2 Plasmid (Nbr Fly)
ExpressionInsectAvailable SinceJuly 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pFUGW-shRIIα
Plasmid#183454PurposesgRNA targeting rat PKA-RIIα subunitsDepositorInsertsgRNA targeting rat PKA-RIIα (Prkar2a Rat)
UseLentiviralPromotershRNA: H1 / gene: ubiquitinAvailable SinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-IAP-del-gRNA1
Plasmid#185002Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertIAP-del-gRNA1 (Akp3 Mouse)
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-MMERVK9C-del-gRNA1
Plasmid#185004Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFPDepositorInsertMMERVK9C-del-gRNA1
UseCRISPRAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Rac-DN(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168243Purpose"Dominant negative control of the assay to rescue Rac expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-DN
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-Rac-CA(guide resistant)-2a-mcherry-U6ac-Rac guides
Plasmid#168244Purpose"Rescue Rac-CA expression in neutrophil specific knockout"DepositorInsertRac(guide resistant)-CA
UseZebrafish expressionTagsmcherryPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV495
Plasmid#177702PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAaGCAGATTAAtGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SRC1p (Debaryomyc…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gT28.3.hSyn.flex.H2B.RFP
Plasmid#170374PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 3. Cre-inducible expression of nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
L2_2xNOP1gRNA-Cas9-CsA
Plasmid#136140PurposePlasmid with 2 different NOP1-gRNA. Targets 500 bp apart in the genome. To tranform Mp as CRISPR control. Contains Cas9 and HygRDepositorInsertp5-35S:HygR p5-MpU6:NOP1gRNA2 p5-MpU6:NOP1gRNA1 p5-MpEF1a:Cas9-NLS
UseSynthetic BiologyExpressionPlantMutationBsaI/ SapI domesticatedAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 RUNX1 g1
Plasmid#155185PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA1DepositorInsertCas13d RUNX1 gRNA1
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P PRIM2_2
Plasmid#160796PurposeSuppress PRIM2DepositorInsertshPRIM2_2
UseLentiviralAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only