Skip to main content

We narrowed to 279 results for: M17

Showing: 21 - 40 of 279 results
  1. pML107-ZIM17

    Plasmid
    #232901
    Purpose
    Plasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.
    Insert
    ZIM17 gRNA (ZIM17 Budding Yeast)
    Use
    CRISPR
    Expression
    Yeast
    Promoter
    snR52
    Available Since
    Feb. 20, 2025
    Availability
    Academic Institutions and Nonprofits only
  2. M17 ptwhh-IGFP65C

    Plasmid
    #17154
    Depositor
    Insert
    twhh promoter (shhb Zebrafish)
    Tags
    b-globin intron, GFP
    Available Since
    Feb. 1, 2008
    Availability
    Academic Institutions and Nonprofits only
  3. pRS314-Cef1-M175I

    Plasmid
    #234118
    Purpose
    Suppressor screen mutant in Cef2
    Depositor
    Insert
    Cef1
    Expression
    Yeast
    Mutation
    M175I
    Available Since
    March 25, 2025
    Availability
    Academic Institutions and Nonprofits only
  4. pCMV6-AN-DDK_S172A_M173A RAD23A

    Plasmid
    #201574
    Purpose
    Expresses a variant of human RAD23A containing mutations S172A and M173A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23A
    Depositor
    Insert
    UV excision repair protein RAD23 homolog A (RAD23A Human)
    Tags
    FLAG
    Expression
    Mammalian
    Mutation
    Contains mutations S172A and M173A
    Available Since
    Nov. 8, 2023
    Availability
    Academic Institutions and Nonprofits only
  5. pCMV6-AN-DDK_S172A_M173A_V195A RAD23A

    Plasmid
    #201576
    Purpose
    Expresses a variant of human RAD23A containing mutations S172A, M173A and V195A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23A
    Depositor
    Insert
    UV excision repair protein RAD23 homolog A (RAD23A Human)
    Tags
    FLAG
    Expression
    Mammalian
    Mutation
    Contains mutations S172A, M173A and V195A
    Available Since
    Nov. 8, 2023
    Availability
    Academic Institutions and Nonprofits only
Showing: 21 - 40 of 279 results