We narrowed to 5,999 results for: pCas
-
Plasmid#233608PurposeExpression of PspCas13b in mammalian cellsDepositorInsertPspCas13b-NES-mCherry
UseCRISPRTags3xFlag and mCherryAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpCas9-2A-GFP-noITR
Plasmid#118415PurposeCas9 GFP plasmid constitutively expressed from CAG promoter. AAV repeat region removed to increase expressionDepositorInsertCas9
UseCRISPRExpressionMammalianAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-dPspCas13b-4EHP-NES-mCherry
Plasmid#233610PurposeExpression of catalytically-inactive PspCas13b fused with 4EHP in mammalian cellsDepositorInsertdPspCas13b-4EHP-NES-mCherry
UseCRISPRTags3xFlag and mCherryMutationH133A/H1058AAvailable SinceMarch 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-SpCas9-miniU6-sgRNAShank3
Plasmid#213973PurposeAAV vector to express SpCas9 driven by pCALM1 promoter for targeting Shank3 locusDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb PspCas13b + PspCas13b guide RNA
Plasmid#176305PurposeExpresses PspCas13b and its associated guide RNA in Drosophila cellsDepositorInsertPspCas13b
TagsHA tagExpressionInsectMutationE113K, N265S- please depositor commentsPromoterUbi-p63eAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUb dPspCas13b + PspCas13b guide RNA
Plasmid#176306PurposeExpresses catalytic dead PspCas13b and its associated guide RNA in Drosophila cellsDepositorInsertPspCas13b
TagsHA tagExpressionInsectMutationH133A, H1058APromoterUbi-p63eAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-HSD17B11
Plasmid#161923PurposeTo generate HSD17B11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against HSD17B11 exon 1.DepositorInsertsgRNA targeting HSD17B11 exon 1
UseCRISPRPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCamKII-Cre-pU6-SpCas9gRNAentry
Plasmid#210391PurposeAAV plasmid encoding the CamKII promoter driving Cre expression, along with SpCas9 gRNA entry cassette (RFP dropout)DepositorInsertAAV-(ITR)-pCamKII-NLS-Cre-WPRE-bGHpA-(rev)-SpCas9_gRNA-BsmBI_RFPcassette-hU6-(ITR) (NJA158)
UseAAV and CRISPRExpressionMammalianPromoterCamKII promoter for Cre, human U6 promoter for Sp…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpCas9-P2A-EGFP (MSP2582)
Plasmid#223067PurposepCAG human codon optimized wild-type SpCas9 expression plasmid with C-terminal NLS(SV40)-3xFLAG-P2A-EGFPDepositorInserthuman codon optimized SpCas9-P2A-EGFP
UseCRISPRTagsNLS(SV40)-3xFLAG-P2A-EGFPExpressionMammalianPromoterCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CBE4max-SpCas9-NG-P2A-EGFP (RTW4554)
Plasmid#140001PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpCas9-NG(D10A/L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) and P2A-EGFPDepositorInserthuman codon optimized CBE4max SpCas9-NG with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpCas9-NG=L1111R/D1135V/G1218R/E121…PromoterCAGAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-DNA-PKcs
Plasmid#220493PurposeTo generate DNA-PKcs KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against DNA-PKcs exon 1.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
opCas12a-T8N (pZZ34, TAT-6MycNLS-opCas12a-2SV40NLS-sfGFP)
Plasmid#199605PurposeExpression of cell permeable opAsCas12a in E. Coli.DepositorInsertopCas12a-T8N
UseCRISPRTags6xHis, Twin-strep, SUMOExpressionBacterialAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJSC114 - Bacterial expression plasmid for SpCas9 eSpCas9(1.1) variant
Plasmid#101215PurposeBacterial expression plasmid for SpCas9 eSpCas9(1.1) variantDepositorInsertSpCas9 variant K848A/K1003A/R1060A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK848A, K1003A and R1060APromoterT7Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
Nickase SpCas9 - pCMV-T7-nSpCas9(H840A)-P2A-GFP (HES140)
Plasmid#208976PurposeNickase SpCas9 (H840A) with a P2A GFP and 3xFLAG, expressed from a CMV or T7 promoters.DepositorInsertnSpCas9(H840)-BPNLS-P2A-GFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only