We narrowed to 144 results for: primer

#201764

For C-terminal tagging of a protein-of-interest with the ALFA tag using S2/S3 primers in yeast

Saravanan Palani

Akhuli et al mSphere. 2022 Oct 26;7(5):e0033322. doi:

Aug. 8, 2023

Academic Institutions and Nonprofits only

#201767

For C-terminal tagging of a protein-of-interest with the ALFA tag using S2/S3 primers in yeast

Saravanan Palani

Akhuli et al mSphere. 2022 Oct 26;7(5):e0033322. doi:

Aug. 8, 2023

Academic Institutions and Nonprofits only

#201766

For C-terminal tagging of a protein-of-interest with the ALFA tag using S2/S3 primers in yeast

Saravanan Palani

Akhuli et al mSphere. 2022 Oct 26;7(5):e0033322. doi:

Aug. 8, 2023

Academic Institutions and Nonprofits only

#99257

Contains expanded CGG repeats (98 repeats with 2 AGG interruptions) within the 5'UTR of FMR1. Internal control with synthetic primer sequence for capillary electrophoresis

Karen Usdin

Hayward et al J Mol Diagn. 2017 Nov;19(6):828-835. doi

Sept. 19, 2017

Academic Institutions and Nonprofits only

#70232

ChEC-tagging vector encoding a 3xFLAG tag and aa 83-231 of Mnase in pFA6a-3HA- HIS3MX6 replacing the 3xHA tag. These vectors retain compatibility with the F2/R1 primer pairs commonly used for epitope

Steven Henikoff

Zentner et al Nat Commun. 2015 Oct 22;6:8733. doi: 10.

Nov. 18, 2015

Academic Institutions and Nonprofits only

#162467

Destination Expression vector for monocot plant primer editing

Adam Bogdanove

Wang et al Front Genome Ed. 2021 Mar 4;3:617553. do

June 23, 2022

Academic Institutions and Nonprofits only

#70234

ChEC-tagging vector encoding a short linker and aa 83-231 of Mnase in pFA6a-3HA-kanMX6 replacing the 3xHA tag. These vectors retain compatibility with the F2/R1 primer pairs commonly used for epitope

Steven Henikoff

Zentner et al Nat Commun. 2015 Oct 22;6:8733. doi: 10.

Nov. 18, 2015

Academic Institutions and Nonprofits only

#68710

Contains the sgRNA backbone sequence (tracrRNA, 82 bp) and is used as DNA template to amplify a specific sgRNA using a forward primer with the protospacer sequence for gene targeting.

Roberto Docampo

Lander et al MBio. 2015 Jul 21;6(4). pii: e01012-15.

Sept. 14, 2015

Industry, Academic Institutions, and Nonprofits

#70233

ChEC-tagging vector encoding a 3xFLAG tag and aa 83-231 of Mnase in pFA6a-3HA-Trp1 replacing the 3xHA tag. These vectors retain compatibility with the F2/R1 primer pairs commonly used for epitope tag

Steven Henikoff

Zentner et al Nat Commun. 2015 Oct 22;6:8733. doi: 10.

Nov. 6, 2015

Academic Institutions and Nonprofits only

#200905

Encodes a mini-transposon derived from Pseudoalteromonas Tn7016,with a CmrR cargo, as well as a primer binding site for deep sequencing purposes at pTarget. Total transposon size = 1,087 bp.

Samuel H. Sternberg

Lampe et al Nat Biotechnol. 2023 Mar 29. doi: 10.103

May 22, 2023

Academic Institutions and Nonprofits only

#241430

Expresses human Histone H3.1 as fusion to GFP with lysine to methionine point mutation of K36 from plasmid H3.1 using primers: forward: ACCGGTGGCGTGATGAAACCTCATCGC & reverse: GCGATGAGGTTTCATC

Cristina Cardoso

Pradhan et al EMBO Rep. 2025 Oct;26(20):4950-4976. doi

June 1, 2026

Academic Institutions and Nonprofits only

#241429

Expresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1

Cristina Cardoso

Pradhan et al EMBO Rep. 2025 Oct;26(20):4950-4976. doi

June 1, 2026

Academic Institutions and Nonprofits only