We narrowed to 6,716 results for: kit
-
Plasmid#176186Purpose2 mu cloning vector for single or multiplexed gRNAs, SNR52p-sfGFP-scRNA-SUP4t-CYC1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pSB700 lenti gRNA Blasto
Plasmid#167904PurposeLentiviral vector for expressing U6 sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT1T2
Plasmid#50593PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT1, gRNA scaffold, OsU3t plus, TaU3p, T2
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKLV-EF1a-BFP-W
Plasmid#208757PurposeLentiviral vector expressing BFPDepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
p3E-FRT-KanR-FRT pA
Plasmid#82601Purpose3' entry vector containing FRT-flanked kanamycin resistance cassette (KanR) with pA for FLP-induced kanamycin resistance, drug selectionDepositorInsertFRT-Kan-FRT
PromoterNoneAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTK312
Plasmid#59569PurposeTC-83 I-SceI T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP XbaI attB1 Kozak EGFP ochre attB2 AscI (truncated E1) 3'UTR Poly A I-SceIDepositorInsertSGP XbaI attB1 Kozak EGFP ochre attB2 AscI
Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTK313
Plasmid#59570PurposeTC-83 I-SceI T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP XbaI attB1 Kozak EGFP-PEST ochre attB2 AscI (truncated E1) 3'UTR Poly A I-SceIDepositorInsertSGP XbaI attB1 Kozak EGFP-PEST ochre attB2 AscI
Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTK194
Plasmid#59563PurposeTC-83 I-SceI T7 5'UTR (A3G) P1234 (nsP2 Q739L) SGP XbaI attB1 Kozak mKate opal attB2 AscI (truncated E1) 3'UTR Poly A I-SceIDepositorInsertSGP XbaI attB1 Kozak mKate opal attB2 AscI
Available SinceAug. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJRA107
Plasmid#209340PurposeGateway cloning compatible binary vector for agrobacterium mediated transformation. Arabidopsis UBQ10 promoter expression of N-terminal mNeonGreen fusion protein.DepositorTypeEmpty backboneExpressionPlantAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_EPHB4
Plasmid#187768PurposeMAC-tagged gene expression of human EPHB4DepositorInsertEPHB4 (EPHB4 Human)
ExpressionMammalianAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
p5E-EF1a/b-actin
Plasmid#82583Purpose5' entry vector containing the EF1a/B-globin fused to zebrafish b-actin 2 enhancer/promoter for strong semi-ubiquitous expressionDepositorInsertEF1a/b-globin fused to zebrafish b-actin 2 enhancer/promoter
PromoterNoneAvailable SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
MTK0_002
Plasmid#123960PurposeEncodes the piggyBac GFP dropout destination vector with the 2xHS4 insulator as a type 0 part to be used in the MTK systemDepositorInsertPB Destination - 2xHS4 - HygroR
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMS114
Plasmid#215677PurposeEmpty repair plasmid for ChrI split hygromycinR landing padDepositorInsert5'HA + MCS + loxN + rps-0p::5'ΔHygR
UseCRISPR and Cre/LoxExpressionWormMutation5' ∆HYGR encodes aa1-226Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
mc2 blast hPGK
Plasmid#206229PurposeFor expressing cloned exons as circular RNA. Alternatively, for expressing cDNA (if the EcoRI-XhoI restriction fragment is also removed).DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceSept. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
Red Glifon 300
Plasmid#163115PurposeRed fluorescent protein-based glucose sensor for mammalian cells with higer affinityDepositorInsertRed Glifon 300
ExpressionMammalianPromoterCMVAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLYS5-SDHB-Flag
Plasmid#50055PurposeExpression of human SDHB in mammalian cellsDepositorAvailable SinceJan. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
GFP-mZO-1(9-1745)-Myc-His
Plasmid#236529PurposeFor expression of ZO-1 (9-1745 aa, mouse)-Myc-His alpha+ in mammalian cellsDepositorAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFH49
Plasmid#128211Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBC-MT2T3
Plasmid#50594PurposeCRISPR/Cas based plant genome editing and gene regulation; used as template for making expression cassette with multiple gRNA target sitesDepositorInsertT2, gRNA scaffold, TaU3t plus, U6-26p, T3
UseCRISPR; Pcr templateExpressionPlantAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only