We narrowed to 7,512 results for: mcherry
-
Plasmid#162779PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to two tyrosine sulfation (TS) motifs. LaM4-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to two TS sites, T7, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialPromoterT7Available sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB-_attB53
Plasmid#183615PurposeRMCE vector to shuttle puromycin resistance (+), anti-GFP SynNotch receptor (+), tagBFP (-) and TRE-mCherry (-) cassettes into attP50-flanked landing pad (Addgene 183609). (+) = sense (-) = antisense.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-CMV-NmCherry-mAID
Plasmid#140601PurposeExpression of OsTIR1 and mCherry-mAID protein in DT40 cells under the control of CMV promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NmCherry-mAID
Plasmid#140603PurposeExpression of OsTIR1 and mCherry-mAID protein in mammalian cells under the control of EF1a promoterDepositorInsertOsTIR1
ExpressionMammalianAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
TB205 △proC △trpR
Bacterial strain#229546PurposeFluorescently labelled (mCherry) E. coli, auxotrophic for proline, tryptophan overproducerDepositorBacterial resistanceNoneAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TB205 △proC △hisL
Bacterial strain#229552PurposeFluorescently labelled (mCherry) E. coli, auxotrophic for proline, histidine overproducerDepositorBacterial resistanceNoneAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNAS1b split mCherry 14-3-3β
Plasmid#111880PurposeMode #2 phosphosite expression (split mCherry, using 14-3-3β binding domain)DepositorTypeEmpty backboneTagsSplit mCherry system: 14-3-3β fused to C-terminal…ExpressionBacterialAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDH1-CMV-FIP200-mCherry-Hygro
Plasmid#210852PurposeLentiviral expression vector encoding FIP200-mCherryDepositorAvailable sinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-LSL-mCherry-shPtbp1
Plasmid#178591PurposeCre-dependent expression of mCherry and a shRNA against Ptbp1 under the constitutive promoterDepositorInsertmiRE-Ptbp1
UseAAVExpressionMammalianAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-OEP7-mCherry
Plasmid#182587PurposeTransient expression of OEP7-mCherry in plant cell (Outer envelope membrane of plastid/chloroplast)DepositorInsertOEP7
TagsmCherryExpressionPlantPromoterCaMV 35S promoterAvailable sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p35S::AtSOBIR1-mCherry
Plasmid#86166PurposeSOBIR1-mCherry expressionDepositorAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHR-YTHDC1-FL-mCherry-Cry2
Plasmid#177124PurposeExpress Full-length YTHDC1 with mCherry and CRY2 tag for Optodroplet AssayDepositorAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTH-NI(A)-mCherry
Plasmid#49626PurposeDestination Vector for TALEColor-mCherryDepositorPublicationTypeEmpty backboneUseTALENTagsmCherryExpressionMammalianPromoterCMVAvailable sinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMT-zic2a-NLS-BirA-2A-mCherry_Ras
Plasmid#80065PurposeZic2a promoter driving HA-tagged biotin ligase (BirA) with NLS, a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA) with nuclear localization signal (NLS), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable sinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-TPD54
Plasmid#172451PurposeExpression of Tumor Protein D52 like 2 (TPD54/TPD52L2) with N-terminal mCherry-FKBP tagDepositorAvailable sinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry-Otx2shRNA1
Plasmid#73979PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of mCherry.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable sinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLentiGuide_mCherry_NT135
Plasmid#183121PurposepLentiGuide modified to express mCherry and a non-targeting sgRNADepositorInsertNT135
UseLentiviralPromoterU6Available sinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only