-
Plasmid#114443PurposeEntry vector for gateway cloning containing human JARID2 coding sequenceDepositorInsertJARID2 (JARID2 Human)
UseGateway entry cloningTagsExpressionMutationPromoterNoneAvailable sinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
tetO-ASCL1-LMX1b-NURR1-PuroR
Plasmid#182298PurposeDoxycycline-inducible vector expressing the ALN transcription factors and PuroR (all separated by 2A sequences)DepositorUseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Ef1a-mClover-W377A/W428A YTHDC1-T2A-BSD-siRNA-Resistant
Plasmid#177130PurposeGenerate lentivirus to introduce mClover tagged m6A binding null mutant W377A/W428A YTHDC1DepositorInsertYTHDC1 (YTHDC1 Human)
UseLentiviralTagsmClover3ExpressionMutationW428A/W377A (m6A binding defects), and siRNA resi…PromoterEf1aAvailable sinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCR8 PALI1
Plasmid#114442PurposeEntry vector for gateway cloning containing human PALI1 coding sequenceDepositorInsertPALI1 (LCOR Human)
UseGateway entry cloningTagsExpressionMutationPromoterNoneAvailable sinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pCAG-MCP-dNS-SRRM1-V5-mCherry
Plasmid#235095PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein with MCP domainDepositorInsertpCAG-MCP-dNS-SRRM1-V5-mCherry (SRRM1 Human)
UseTagsExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable sinceMay 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry
Plasmid#235096PurposeSRRM1 lacking Nuclear Speckle domain (dNS-SRRM1) mCherry fusion protein without MCP domainDepositorInsertpCAG-SpyTag-Flag-dNS-SRRM1-V5-mCherry (SRRM1 Human)
UseTagsExpressionMammalianMutationThe SRRM1 entry clone from DNASU was modified usi…PromoterCAGAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Nterm_FlagHa
Plasmid#127343PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningTagsFlag- HA- Tandem EpitopesExpressionMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable sinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXBI-mClover-YTH domain
Plasmid#177123PurposeBacterial expression of YTH domain of YTHDC1 tagged with N-terminal mClover3 and C-terminal Mxe GtrA intein-Chitin binding domain for protein purificationDepositorInsertYTHDC1 (YTH domain) (YTHDC1 Human)
UseTagsMxe GyrA intein-Chitin binding domain for protein…ExpressionBacterialMutationYTH domain only (IDR1 and IDR2 deletion)PromoterT7Available sinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXBI-mclover-YTH-IDR2
Plasmid#177122PurposeBacterial expression of YTH-IDR2 fragment of YTHDC1 tagged with N-terminal mClover3 and C-terminal Mxe GtrA intein-Chitin binding domain for protein purificationDepositorInsertYTHDC1 (YTH and IDR2 domains) (YTHDC1 Human)
UseTagsMxe GyrA intein-Chitin binding domain for protein…ExpressionBacterialMutationYTH and IDR2 domains only (IDR1 deletion)PromoterT7Available sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFOSGE_COF2F04
Plasmid#70901PurposeGateway entry cloneDepositorInsertmod(mdg4) (mod(mdg4) Fly)
UseGateway entry vectorTagsExpressionMutationPromoterAvailable sinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available sinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mAscl1
Plasmid#198755PurposeVector encodes the gene for murine Ascl1 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorInsertAscl1 (Ascl1 Mouse)
UseLentiviralTagsExpressionMutationPromoterTRE3GAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV[TetOn]-Puro-TRE3G>mNeurog2
Plasmid#198754PurposeVector encodes the gene for murine neurogenin-2 under control of a Tet-controlled promoter and the puromycin resistance gene under control of a constitutive PGK promoterDepositorInsertNeurogenin-2 (Neurog2 Mouse)
UseLentiviralTagsExpressionMutationPromoterTRE3GAvailable sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B
Plasmid#133308PurposeExpression of luciferase driven by eIF3B promoter regionDepositorInserteIF3B promoter (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationPromotereIF3BAvailable sinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE3 mutant
Plasmid#133310PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 3DepositorInserteIF3B promoter MBE3 mutant (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationccacgtgacc changed to cAaAAAAaccPromotereIF3BAvailable sinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE2 mutant
Plasmid#133309PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 2DepositorInserteIF3B promoter MBE2 mutant (EIF3B Human)
UseLuciferaseTagsExpressionMammalianMutationgccacatgcacc changed to gcAaAaAAcaccPromotereIF3BAvailable sinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only