We narrowed to 7,585 results for: mCherry
-
Bacterial strain#229546PurposeFluorescently labelled (mCherry) E. coli, auxotrophic for proline, tryptophan overproducerDepositorBacterial resistanceNoneAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only
-
TB205 △proC △hisL
Bacterial strain#229552PurposeFluorescently labelled (mCherry) E. coli, auxotrophic for proline, histidine overproducerDepositorBacterial resistanceNoneAvailable sinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-HMBG1
Plasmid#215130PurposeExpresses mCherry-HMBG1 in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APEX1
Plasmid#215126PurposeExpresses mCherry-APEX1 in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available sinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MLS-TIR1-P2A-mCherry
Plasmid#246222PurposeExpression of MLS-TIR1-P2A-mCherryDepositorInsertMLS-TIR1
TagsMLSExpressionMammalianAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2 - myo6b:CaSR-EGFP, cryaa:mCherry
Plasmid#191500PurposeGROW AT 30 DEGREES. A construct used to create transgenic fish that express CaSR-EGFP in hair cells and an mCherry marker in the lens of the eyeDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCaSR-EGFP-SV40
UseCreation of transgenic fish using tol2 transgenes…Promotermyo6bAvailable sinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-CMV-NmCherry-mAID
Plasmid#140601PurposeExpression of OsTIR1 and mCherry-mAID protein in DT40 cells under the control of CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOsTIR1
ExpressionMammalianAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAID1.2-EF1a-NmCherry-mAID
Plasmid#140603PurposeExpression of OsTIR1 and mCherry-mAID protein in mammalian cells under the control of EF1a promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertOsTIR1
ExpressionMammalianAvailable sinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNAS1b split mCherry 14-3-3β
Plasmid#111880PurposeMode #2 phosphosite expression (split mCherry, using 14-3-3β binding domain)DepositorTypeEmpty backboneTagsSplit mCherry system: 14-3-3β fused to C-terminal…ExpressionBacterialAvailable sinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDH1-CMV-FIP200-mCherry-Hygro
Plasmid#210852PurposeLentiviral expression vector encoding FIP200-mCherryDepositorAvailable sinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-LSL-mCherry-shPtbp1
Plasmid#178591PurposeCre-dependent expression of mCherry and a shRNA against Ptbp1 under the constitutive promoterDepositorInsertmiRE-Ptbp1
UseAAVExpressionMammalianAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
p35S::AtSOBIR1-mCherry
Plasmid#86166PurposeSOBIR1-mCherry expressionDepositorAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGWT35S-OEP7-mCherry
Plasmid#182587PurposeTransient expression of OEP7-mCherry in plant cell (Outer envelope membrane of plastid/chloroplast)DepositorInsertOEP7
TagsmCherryExpressionPlantPromoterCaMV 35S promoterAvailable sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-YTHDC1-FL-mCherry-Cry2
Plasmid#177124PurposeExpress Full-length YTHDC1 with mCherry and CRY2 tag for Optodroplet AssayDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertYTHDC1 (YTHDC1 Human)
TagsmCherry-CRY2ExpressionMammalianPromoterSFFVAvailable sinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTP3-AAV-RBFOX3enhancer-mCherry
Plasmid#254715PurposeThis AAV vector contains an enhancer that drives mCherry expression in spinal cord skeletal motor neurons of alpha subtype. Specificity of vector not characterized outside the mouse spinal cord.DepositorInsertRBFOX3 enhancer, mini promoter, synthetic intron, mCherry, WPRE (Rbfox3 Synthetic, Mouse)
UseAAV and Mouse TargetingExpressionMammalianAvailable sinceJune 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pET24a-LaM4-2xTS
Plasmid#162779PurposeBacterial expression of a functionalized anti-mCherry (LaM4) nanobody fused to two tyrosine sulfation (TS) motifs. LaM4-2xTS also contains a T7, HA, BAP and His6 epitopeDepositorInsertanti-mCherry nanobody fused to two TS sites, T7, HA, BAP and His6 epitope
TagsBAP, HA, His6, T7, and TS site from proCCKExpressionBacterialPromoterT7Available sinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
attB53_SNCB-_attB53
Plasmid#183615PurposeRMCE vector to shuttle puromycin resistance (+), anti-GFP SynNotch receptor (+), tagBFP (-) and TRE-mCherry (-) cassettes into attP50-flanked landing pad (Addgene 183609). (+) = sense (-) = antisense.DepositorInsertsLaG17 GFP nanobody SynNotch tTA
TRE-mCherry-SV40pA
tagBFP
UseRmceTagsMyc and human CD8a signal sequenceExpressionMammalianAvailable sinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
hPLD3-sgRNA-Cas9_mcherry
Plasmid#199342Purposeencodes sgRNA for human PLD3 KO, (target Exon 7) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-RFPExpressionMammalianPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only