We narrowed to 11,024 results for: cat.1
-
Plasmid#224346PurposeExpresses human KDAC6 (HDAC6) in insect cellsDepositorAvailable SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Gfp-rt-vasa
Plasmid#167322PurposePlasmid for synthesis of GFP chimeric RNA that contained vasa-3'UTRs of rainbow trout by in vitro transcription.DepositorInsertrt vasa 3'UTRs (ddx4 rainbow trout)
ExpressionBacterialAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-161;+80pCalb2
Plasmid#66745Purposeluciferase reporter for Calb2 promoter (-161to +80, WT)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-264;+80pCalb2
Plasmid#66746Purposeluciferase reporter for Calb2 promoter (-264 to +80, WT)DepositorInsertCalb2 promoter (-264bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-419;+80pCalb2
Plasmid#66747Purposeluciferase reporter for Calb2 promoter (-419 to +80, WT)DepositorInsertCalb2 promoter (-419bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28a-his-Gluc-iLID
Plasmid#172096PurposeExpresses a fusion protein of Gluc and iLID, which dimerizes with a sspB-tagged protein when the bioluminescent reaction is initiated, in bacteriaDepositorInsertGaussia Luciferase - iLID
ExpressionBacterialMutationGluc Mutations - M43L, M110LPromoterT7Available SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
hHSF1 S303A
Plasmid#118363PurposeThis plasmid expresses human HSF1 S303A mutant, which cannot undergo sumoylation on K298 due to disrupted PDSM motif.DepositorAvailable SinceNov. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET28a-Gluc-EL222-his
Plasmid#172097PurposeExpresses the fusion protein of Gluc and the light-activated transcription factor EL222 in bacteriaDepositorInsertGaussia Luciferase - EL222
ExpressionBacterialMutationGluc mutations - M43L, M110LPromoterT7Available SinceApril 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTriEx4-ADCY6-C1(306-672 aa)
Plasmid#113903PurposeHis-S tagged cytoplasmic catalytic domain 1 of Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 cytoplasmic catalytic domain 1 (ADCY6 Human)
TagsHis-SExpressionBacterial, Insect, and Mamm…PromoterT7, CMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKTop::tse5-CT (1169-1281)
Plasmid#192955PurposeFor membrane insertion study; Expresses tse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1281)
ExpressionBacterialMutationencodes for tse5 (1169-1281)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-838;+80pCalb2
Plasmid#66750Purposeluciferase reporter for Calb2 promoter (-838 to +80, WT)DepositorInsertCalb2 promoter (-838bp +80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT21
Plasmid#78102Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 2…PromoterT7Available SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pETDuet-msGC-NT13
Plasmid#75087Purposeexpresses the N-terminal fragment of manduca sexta soluble guanylyl cyclase subunits alpha and betaDepositorInsertsfragment of alfa subunit of sGC
fragment of beta subunit of sGC
TagsHis-tagExpressionBacterialMutationfragment 1-380 of the beta subunit and fragment 4…Available SinceMay 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 RL3m6L2
Plasmid#109366PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tagDepositorInsertTags1D4ExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YOLCd1b
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(WT)-mascRNA](pAVA2987)
Plasmid#239348PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
STIM1ct-ssrA2-mCerulean
Plasmid#223690PurposePhoBIT2 component; ssrA2 tag (ssrA mutant A2C) inserted into mCerulean-tagged STIM1 cytoplasmic domainDepositorAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastBacI-KDAC8
Plasmid#224343PurposeExpresses human KDAC8 (HDAC8) in insect cellsDepositorAvailable SinceFeb. 26, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSuper DGK zeta human
Plasmid#224575PurposeTo downregulate the expression of human DGK zeta in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only