We narrowed to 4,731 results for: gca
-
Plasmid#225875PurposeGuides targeting RB1 and a control sequenceDepositorAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pLenti-multi-CRISPR-sgMlkl_#2-puro
Plasmid#231980PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK2 gRNA (BRDN0001148577)
Plasmid#75638Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL G44S (siRNA resistant)
Plasmid#191012PurposeExpresses EGFP-tagged kinase-dead MASTL G44S with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationG44SAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD S1406A
Plasmid#169820PurposeExpresses C-terminal flag-tagged CAD with mutation of reported PKA phosphorylation siteDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationS1406A; TCCC -> AGTC silent mutations at nt527…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB09-TRE-beta-globin-miR-124-EF1a-GFP
Plasmid#117318PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseTransposon-mediated integrationTagsGFPExpressionMammalianPromoterTet-inducible promoterAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
MAPK14 gRNA (BRDN0001487162)
Plasmid#77925Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK14DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
JAK1 gRNA (BRDN0001145887)
Plasmid#76392Purpose3rd generation lentiviral gRNA plasmid targeting human JAK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV Jph3gRNA mEmerald hSyn mTagBFP2-CAAX2
Plasmid#236246PurposeEndogenous tagging of Junctophilin 3 with mEmerald with a fluorescent marker for the plasma membraneDepositorInsertgRNA for rat Jph3, mEmerald donor and mTagBFP2-CAAX2
UseAAVTagsmTagBFP2PromoterU6 and human Synapsin1Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK2 gRNA (BRDN0001146342)
Plasmid#75637Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-RNF2-ngRNA+41_EF1a-puroR
Plasmid#207358PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 nicking guide RNA and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 +41 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146195)
Plasmid#76082Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALPK1 gRNA (BRDN0001146035)
Plasmid#76081Purpose3rd generation lentiviral gRNA plasmid targeting human ALPK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMPUW-miR-124-GFP-Puro
Plasmid#117321PurposeOverexpression of miR-124 in eurkaryotic cells, encoded in a human beta-globin intronDepositorInserthsa-miR-124-1 (MIR124-1 Human)
UseLentiviralTagsGFP-PuroExpressionMammalianPromoterEF1aAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKeap1#1/Cre
Plasmid#173639PurposeExpresses a Keap1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Keap1 (Keap1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_human_ADAR2_ccA
Plasmid#158114Purposedeletion hADAR2DepositorInsertADAR2 (ADARB1 Human)
ExpressionMammalianAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgIl1r1_#2-hygro
Plasmid#231990PurposeKnockout mouse Il1r1DepositorInsertsgRNA with Cas9 and hygromycin resistance (Il1r1 Mouse)
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMC00005
Plasmid#166722PurposesgRNA against human ASNSDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only