We narrowed to 795 results for: PA-GFP
-
Plasmid#47353PurposeClock fragment cloned and tagged with VenNDepositorAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only
-
HLH Bmal Pas 1-465-VenC
Plasmid#47364PurposeBmal fragment cloned with Venus tag and used for BiFCDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
MCS-T2a-GFPnls-ER-Cre-ER
Plasmid#200104PurposeVector For TwistDepositorTypeEmpty backboneUseUnspecifiedAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA
Plasmid#74302PurposeExpression of Magneto2.0-p2A-mCherry in Rohon-Beard sensory neurons of the zebrafishDepositorUseZebrafishTagsFLAG, cmcl2::EGFP, and p2A-mCherryMutationTRPV4: delta 760-871PromoterNeurog1Available SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gLacZ dCas9-KRAB-T2a-GFP
Plasmid#234883Purposenon-targeting CRISPRi controlDepositorInsertL1HS gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pALS2-sfGFP 150TAG
Plasmid#197574PurposeFluorescence selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses sfGFP-150TAG and M. alvus Pyl-tRNA(6). p15a origin of replication.DepositorInsertssfGFP 150TAG
M. alvus Pyl-tRNA (6)
TagsHis6ExpressionBacterialMutationN150TAGPromoteraraC and lppAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-mouse Gfi1-IRES-GFP
Plasmid#91893PurposeMammalian expression of mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSAD-5PSD95-EGFP-SynPhRFP
Plasmid#217979PurposeG-Deleted Rabies genomic plasmid to express 5PSD95-EGFP and SynPhRFPDepositorUseG-deleted rabiesTagsEGFP and RFPPromoterNoneAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSCV-dGFP-JARID1C A388P
Plasmid#74778Purposeretroviral expression of JARID1C A388PDepositorAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-APLP1ICD-IRES-hrGFP
Plasmid#107546PurposeAAV-mediated expression of last 50 amino acids of APLP1 protein (APLP1ICD) and IRES-mediated co-expression of hrGFP to recognize labelled cellsDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-mouse Gfi1-IRES-GFP
Plasmid#91891PurposeRetroviral expression of mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
sgGFP_3
Plasmid#78165PurposesgGFPDepositorInsertGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Mb-sfGFP 150TAG
Plasmid#197570PurposeExpression of sfGFP 150TAG with Methanosarcina barkeri (Mb) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP 150TAG
Pyl-tRNA (4 copies)
TagsV5-His6ExpressionMammalianMutationN150TAGPromoterCMV and U6/H1Available SinceApril 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRC54-DHX37-GFP
Plasmid#192149Purposeexpress DHX37-GFPDepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-Ma-sfGFP 150TAG
Plasmid#197568PurposeExpression of sfGFP-150TAG with Methanomethylophilus alvus (Ma) Pyl-tRNA for the encoding of non-canonical amino acids at TAG codons in HEK293 cellsDepositorInsertssfGFP 150TAG
M. alvus Pyl-tRNA (6) (4x copies)
TagsV5-His6ExpressionMammalianMutationN150TAGPromoterCMV and U6/H1Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRC55-GFP-DHX37
Plasmid#192150Purposeexpress GFP-DHX37DepositorAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT2K-p53DN-T2A-copGFP
Plasmid#109229PurposeFor Tol2 transposon-mediated stable expression of dominant negative p53 and copGFPDepositorInsertdominant negative p53 (Trp53 Mouse)
TagscopGFPExpressionMammalianMutationdominant negative p53PromoterCAGGSAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only